covid 19 fasta Document covid 19 fasta 

Retour à l'accueil du site

Document crée le: 20220410- mis à jour le : 20220410- Page html généré le: 20220428_234610

1.Covid 19 fasta

  • 22/04/2020 17:18:16 analyse de l'Ă©tude de Jean Claude Perez Ă  laquelle s'est rĂ©fĂ©rĂ© Luc Montagnier pour sa dĂ©claration : ( professeur_luc_montagnier_le_virus_covid19_est_une_manipulation_humaine_ ) , ci-dessous le lien de l'Ă©tude: wuhan_covid_19_synthetic_origins_and_evolution_Jean_Claude_PEREZ_

    extrait du résumé de l'étude:

    Le principal résultat de cette mise à jour est la preuve formelle que le coronavirus 2019-nCoV est en partie un génome SYNTHéTIQUE. Nous prouvons la CONCENTRATION dans une petite région de wuhan Nouveau génome (300bp) de 3 régions différentes du gène HIV1 ENVELOPPE et 3 autres de HIV2 et SIV (ENV et POL RT). Tout cela est remarquable et porte la marque d'un désir d'organisation de nature humaine : LOGIQUE, SYMéTRIES.

    WUHAN COVID-19 SYNTHETIC ORIGINS AND EVOLUTION Jean-Claude PEREZ Phd Maths & Computer Science Bordeaux University, RETIRED Interdisciplinary Researcher (IBM Emeritus, IBM European Research Center on Artificial Intelligence) Jean-Claude PEREZ

  • 22/04/2020 17:18:16 analyse de l'Ă©tude de Jean Claude Perez Ă  laquelle s'est rĂ©fĂ©rĂ© Luc Montagnier, ce dessous le lien de l'Ă©tude:
  • 28/04/2020 16:38:16 une nouvelle publication en collaboration avec le professeur Luc Montagnier ici covid_19_sars_and_bats_coronaviruses_genomes_unexpected_exogeneous_rna_sequences_

    résumé :

  • j'ai rĂ©cupĂ©rĂ© les codes FASTA des sĂ©quences HIV (virus du sida) ainsi que des gĂ©nomes complet du premiers SARS de 2003 et du dernier sĂ©quençage de 2019
  • j'ai vĂ©rifiĂ© la prĂ©sence de ces sĂ©quences dans le gĂ©none du virus du covid-19
  • ses sĂ©quences ont une longeur d'environ 30 paires de bases. Je ne sais pas si c'est significatif mais pour Luc Montagnier et Jean-Claude Perez cela semble hautement significatif.
  • le code fasta du premier SARS datant de 2003 ne contient pas ces sĂ©quences de HIV.
  • si comme le dise les dĂ©tracteurs, la prĂ©sence de ses sĂ©quences ne veut rien dire parce qu'on les trouve par ailleurs (et on aimerai bien qu'ils nous disent oĂą) alors il est Ă©tonnant que ces sĂ©quences ne soit pas dans le virus d'origine.
    Le virus intelligent aurait su pour devenir plus dangereux qu'il devait se procurer à tous prix des éléments du VIH ? où ? dans le pangolin ?
  • je fais une recherche avec l'outil Blast_ du NCBI_ pour trouver la plus grande sĂ©quence je la trouve en premier dans le virus du covid-19 (SARS-CoV2 100 premiers rĂ©sultats), je met alors un filtre sur HIV et je trouve la sĂ©quence mais pas complète seulement 85% (colonne "Query cover") ensuite je filtre pour exclure Ă  la fois le SARS-CoV2 et le HIV et j'obtiens seulement un rĂ©sultat complet sur la sĂ©quence de 28 pb (paire de base) qui est un ADN artificiel , le "Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and N genes" MT108784_1_ (mais c'est normal vu le titre de l'Ă©tude associĂ©e "Rapid reconstruction of SARS-CoV-2 using a synthetic genomics platform" ) les autres rĂ©sultats sont partiels avec des sĂ©quences sensiblement infĂ©rieures.
  • le seul gĂ©nome contenant toutes ses sĂ©quences est artificiel - ensuite l'aigle royal en possĂ©de deux : rĂ©sultat des recherches des sĂ©quences hiv dans ncbi genome
  • il est extrĂŞmement curieux qu'une sĂ©rie de fragments de gĂ©nome qui n'appartiennent qu'Ă  un virus le HIV et qui n'apparraissent pas dans le coronavirus SARS 2003 se retrouvent prĂ©sentent dans la dernière version du coronavirus SARS-CoV2 et nulle part ailleurs que dans des chimères de laboratoire.
  • la sĂ©quence Ă©tudiĂ©e de 28 pb, correspond Ă  une probabilitĂ© que l'on peut facilement calculer. Comme il y a 4 pb (paire de base), une sĂ©quence de 28 correspond Ă  faire 28 fois le choix d'une de ces bases, le nombre de combinaison est donc de 4 Ă  la puissance 28: 4^28= 7.2 E+016 donc 10 Ă  la puissance 16, c'est Ă  dire 70 millions de milliard de possibilitĂ©s. Par comparaison le nombre d'espèce sur notre planète y compris les micro-organismes est Ă©valuĂ© Ă  10 Ă  la puissance 12, cf. sciencepost_fr_il_y_a_plus_despeces_de_microbes_sur_terre_que_detoiles_dans_toute_la_galaxie_
  • par contre je n'ai pas rĂ©ussi Ă  trouver les sĂ©quences HIV de l'Ă©tude dans leur origine sous NCBI..., par exemple :

    1.0.1.Analyse Covid 19

  • le code FASTA pour les sequences ADN est composĂ© des bases A,T,G,C.
  • ci-dessous les sequences HIV dĂ©tectĂ©e dans le dernier sĂ©quençage du virus WUHAN (23 January 2020) Wuhan Seafood Market Pneumonia Virus Isolate Wuhan-Hu-1, Complete Genome GenBank: MN908947.3 selon l'article.
  • vous pouvez sĂ©lectionner ces sĂ©quences et faire CTRL-F dans votre navigateur pour les rechercher dans le gĂ©nome des virus. La recherche ne peut gĂ©nĂ©ralement aboutir que dans la chaĂ®ne complĂ©te concatĂ©nĂ©e sur un seul ligne car les cĂ©sures de retour Ă  la ligne dans le code FASTA peuvent couper une sĂ©quence. j'ai procĂ©dĂ© Ă  cette concatĂ©nation ce qui donne des lignes composĂ©e de plusieurs dizaines de milliers de caractères.

    Region HIV1a 86-113: HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete cds Sequence ID: GU455503.1Length: 2598Number of Matches: 1 AATGGTACTAAGAGGTTTGATAACCCTG

    Region HIV1b 213-244: HIV-1 isolate 4045_Plasma_Visit1_amplicon5a from Malawi envelope glycoprotein (env) gene, complete cds Sequence ID: KC187063.1Length: 2547Number of Matches: 1 CCCTACTTATTGTTAATAACGCTACTAATGTT

  • hiv 1 isolate 4045 plasma visit1 amplicon5a from malawi envelope glycoprotein env gene complete cds 39600538_Wuhan_and_SARS_Coronavirus_perez_release7_perez

    Region HIV1c 243-281: HIV-1 isolate 07.RU.SP-R497.VI.G3 from Russia envelope glycoprotein (env) gene, complete cds Sequence ID: GU481453.1Length: 2580Number of Matches: 1 TTGTTATTAAAGTCTGTGAATTTCAATTTTGTAATGATC

    Region HIV2a 24-43: HIV-2 isolate 106CP_RT from Cote d'Ivoire reverse transcriptase gene, partial cds Sequence ID: KJ131112.1Length: 924Number of Matches: 1 ACTTGTTCTTACCTTTCTTT

    Region HIV2b 133-158: Human immunodeficiency virus type 2 complete genome from strain HIV-2UC1 Sequence ID: L07625.1Length: 10271Number of Matches: 1 TGTTTATTTTGCTTCCACTGAGAAGT

  • j'ai vĂ©rifiĂ© la prĂ©sence de ces sĂ©quences dans le gĂ©none du virus du covid-19
  • j'ai opĂ©rĂ© le retour Ă  la ligne Ă  l'endroit des sĂ©quences pour plus de lisibilitĂ©, deux sĂ©quences sont contigues et se chevauchent lĂ©gĂ©rement d'ailleurs: Region HIV1b 213-244 et Region HIV1c 243-281:

  • le code FASTA du gĂ©nĂ©ome du virus du COVID19 WUHAN (23 January 2020) Wuhan Seafood Market Pneumonia Virus Isolate Wuhan-Hu-1, Complete Genome GenBank: MN908947.3
    MN908947.3 Severe acute respiratory syndrome coronavirus 2 isolate Wuhan-Hu-1, complete genome


  • le code fasta du premier SARS datant de 2003 ne contient pas ses sĂ©quences de HIV.
    si comme le dise les détracteurs la présence de ses séquences ne veut rien dire parce qu'on les trouve par ailleurs (et on aimerai bien qu'ils nous disent où) alors il est étonnant que ces séquences ne soit pas dans le virus d'origine.
    Le virus intelligent aurait su pour devenir plus dangereux qu'il devait se procurer à tous prix des éléments du VIH ? où ? dans le pangolin ?

    SARS2003 SARS Coronavirus SZ16, Complete Genome
    AY304488.1 SARS coronavirus SZ16, complete genome

    AY304488.1 SARS coronavirus SZ16, complete genome


  • comme ils ne nous le disent pas , j'ai fait une recherche. je recherche la plus grande sĂ©quence (pour une plus grande discrimination) :

    Region HIV1a 86-113: HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete cds Sequence ID: GU455503.1Length: 2598Number of Matches: 1 AATGGTACTAAGAGGTTTGATAACCCTG

    dans le HIV et effectivement je l'obtiens :

  • ensuite je rajoute le filtre pour ne plus voir le HIV et les 100 premiers rĂ©sultat concerne tous le virus SARS-Cov2

  • enfin je rajoute le filtre pour ne plus voir le HIV et le SARS-Cov2 et j'obtiens le rĂ©sultat suivant dans lequel la sĂ©quence complète n'apparait que dans "Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and N genes" c'est Ă  dire une sĂ©quence rĂ©sultant de bio-ingĂ©nierie. Les autres rĂ©sultats ne comprennent que des sous-sĂ©quences de la sĂ©quence recherchĂ©e. cf :

  • document adue0pd001r alignment 

    On trouve aussi un résultat significatif dans le "Bat coronavirus RaTG13, complete genome" mais la séquence n'est pas continue
    image du matching:

    - complet:
    "Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and N genes"

    - partiel non contigue avec 4 pb en moins:
    "Bat coronavirus RaTG13, complete genome"
    ||||||| ||| ||||||||||||||

    - partiel avec 7 pb en moins
    Gossypium raimondii isolate D5-4 chromosome D5_03
    |||||||| ||||||||||||Ă©sultat des recherches des sĂ©quences hiv dans ncbi genome

  • fichiers rĂ©sultat des recherches des sĂ©quences HIV dans NCBI genome:
  • rĂ©sultat des recherches avec un taux de 100%
  • le seul rĂ©sultat qui contient toutes les sĂ©quences est le MT108784.1 "Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and..."
  • un seul autre organisme en possède deux, le Aquila chrysaetos ou Aigle royal

    cds cds cds cds
     Max  TotalQueryE  Per.    
    Description  ScoreScorecoverValueIdent Accession  
    === Human immunodeficiency virus type 2 complete genome from strain HIV-2UC1
    Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 52.0  52.0  100%  3e-04100.00  MT108784.1  
    Canis lupus familiaris breed Labrador retriever chromosome 34a  36.2  100  100%  18  92.31  CP050605.1  
    PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XM_025425478.1
    === HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete
    Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 56.0  56.0  100%  3e-05100.00  MT108784.1  
    Aquila chrysaetos chrysaetos genome assembly, chromosome: 1  34.2  66.4  100%  99  100.00  LR606181.1  
    === HIV-1 isolate 4045_Plasma_Visit1_amplicon5a from Malawi envelope glycoprotein (env) gene, complete
    Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 63.9  63.9  100%  2e-07100.00  MT108784.1  
    === HIV-2 isolate 106CP_RT from Cote d'Ivoire reverse transcriptase gene, partial
    Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 40.1  40.1  100%  0.46  100.00  MT108784.1  
    Salarias fasciatus genome assembly, chromosome: 12  40.1  40.1  100%  0.46  100.00  LR597447.1  
    Morus alba cultivar Heyebai chromosome 1  36.2  541  100%  7.2  100.00  CP050224.1  
    Lotus japonicus B-129 DNA, chromosome 6, complete sequence  36.2  159  100%  7.2  100.00  AP022634.1  
    Chanos chanos genome assembly, chromosome: 4  36.2  126  100%  7.2  100.00  LR697109.1  
    Myripristis murdjan genome assembly, chromosome: 22  36.2  98.6  100%  7.2  100.00  LR597571.1  
    Streptopelia turtur genome assembly, chromosome: 7  36.2  161  100%  7.2  100.00  LR594557.1  
    Streptopelia turtur genome assembly, chromosome: Z  36.2  278  100%  7.2  100.00  LR594555.1  
    Gouania willdenowi genome assembly, chromosome: 21  36.2  128  100%  7.2  100.00  LR132001.1  
    Eukaryotic synthetic construct chromosome 15  36.2  98.6  100%  7.2  100.00  CP034493.1  
    === HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete
    Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 56.0  56.0  100%  3e-05100.00  MT108784.1  
    Aquila chrysaetos chrysaetos genome assembly, chromosome: 1  34.2  66.4  100%  99  100.00  LR606181.1  
    18.000000         hiv 1 isolate 19663 24h9 from netherlands envelope glycoprotein  gene complete cds

    HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete cds

    GenBank: GU455503.1

    GenBank Graphics PopSet

    GU455503.1 HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete cds


    GU455503.1 HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete cds


    HIV-1 isolate 4045_Plasma_Visit1_amplicon5a from Malawi envelope glycoprotein (env) gene, complete cds GenBank: KC187063.1 GenBank Graphics PopSet


    KC187063.1 HIV-1 isolate 4045_Plasma_Visit1_amplicon5a from Malawi envelope glycoprotein (env) gene, complete cds


    Human immunodeficiency virus 1, complete genome NCBI Reference Sequence: NC_001802.1 GenBank Graphics

    NC_001802.1 Human immunodeficiency virus 1, complete genome


    NC_001802.1 Human immunodeficiency virus 1, complete genome


  • document wuhanrel5 jcplm versionosf preprint 

    2.Orf8: :20200924

    2.1.Orf8 fasta: :20200924