Afwv71m0014 alignment txt

créé le: 20200428
mis à jour le: 20200428
généré le:20200525_110108

Region HIV2b 133-158: Human immunodeficiency virus type 2 complete genome from strain HIV-2UC1 Sequence ID: L07625.1Length: 10271Number of Matches: 1 TGTTTATTTTGCTTCCACTGAGAAGT

RID: AFWV71M0014 Job Title:Nucleotide Sequence Program: BLASTN Database: nt Nucleotide collection (nt) Query #1: Query ID: lcl|Query_38427 Length: 26

Sequences producing significant alignments:

 Max  TotalQueryE  Per.    
Description  ScoreScorecoverValueIdent Accession  
Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 52.0  52.0  100%  3e-04100.00  MT108784.1  
Canis lupus familiaris breed Labrador retriever chromosome 34a  36.2  100  100%  18  92.31  CP050605.1  
Canis lupus familiaris breed Labrador retriever chromosome 17a  36.2  197  100%  18  100.00  CP050603.1  
Canis lupus familiaris breed Labrador retriever chromosome 17b  36.2  197  100%  18  100.00  CP050614.1  
Canis lupus familiaris breed Labrador retriever chromosome 34b  36.2  100  100%  18  92.31  CP050608.1  
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XM_025425478.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XR_003127332.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XR_003127331.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XR_003127330.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XR_003127329.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XR_003127328.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XM_025425476.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XM_025425475.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XM_025425474.1
PREDICTED: Canis lupus dingo zinc finger B-box domain containi... 36.2  36.2  100%  18  92.31  XM_025425473.1
Pseudochaenichthys georgianus genome assembly, chromosome: 1  36.2  36.2  69%  18  100.00  LR792546.1  
Canis lupus familiaris breed Labrador retriever chromosome 24a  36.2  36.2  69%  18  100.00  CP050588.1  
Canis lupus familiaris breed Labrador retriever chromosome 08a  36.2  36.2  69%  18  100.00  CP050567.1  
Canis lupus familiaris breed Labrador retriever chromosome 24b  36.2  36.2  69%  18  100.00  CP050643.1  
Canis lupus familiaris breed Labrador retriever chromosome 08b  36.2  36.2  69%  18  100.00  CP050639.1  
PREDICTED: Amblyraja radiata cadherin-20-like (LOC116990886),...  36.2  36.2  69%  18  100.00  XM_033049008.1
PREDICTED: Amblyraja radiata cadherin-20-like (LOC116990886),...  36.2  36.2  69%  18  100.00  XM_033049001.1
Candida glabrata strain ATCC 2001 chromosome K  36.2  36.2  69%  18  100.00  CP048128.1  
Carnobacterium maltaromaticum strain 18ISCm chromosome, comple... 36.2  36.2  69%  18  100.00  CP045040.1  
Sciurus carolinensis genome assembly, chromosome: 15  36.2  68.4  69%  18  100.00  LR738605.1  
Neostethus bicornis genome assembly, chromosome: 8  36.2  68.4  69%  18  100.00  LR738556.1  
Neostethus bicornis genome assembly, chromosome: 3  36.2  36.2  69%  18  100.00  LR738543.1  
Pecten maximus genome assembly, chromosome: 5  36.2  36.2  69%  18  100.00  LR736842.1  
PREDICTED: Clupea harengus WD repeat domain 75 (wdr75), mRNA  36.2  36.2  69%  18  100.00  XM_012842315.2
uncultured bacterium partial 16S rRNA gene  36.2  36.2  69%  18  100.00  LR635228.1  
uncultured bacterium partial 16S rRNA gene  36.2  36.2  69%  18  100.00  LR645726.1  
Thermosynechococcus sp. CL-1 chromosome, complete genome  36.2  36.2  69%  18  100.00  CP040671.1  
PREDICTED: Cannabis sativa pentatricopeptide repeat-containing... 36.2  36.2  69%  18  100.00  XM_030645212.1
PREDICTED: Cannabis sativa pentatricopeptide repeat-containing... 36.2  36.2  69%  18  100.00  XM_030645211.1
PREDICTED: Cannabis sativa pentatricopeptide repeat-containing... 36.2  36.2  69%  18  100.00  XM_030645210.1
PREDICTED: Cannabis sativa pentatricopeptide repeat-containing... 36.2  36.2  69%  18  100.00  XM_030645209.1
Sphaeramia orbicularis genome assembly, chromosome: 17  36.2  36.2  69%  18  100.00  LR597474.1  
Microcaecilia unicolor genome assembly, chromosome: 14  36.2  36.2  69%  18  100.00  LR594645.1  
PREDICTED: Dendrobium catenatum heterogeneous nuclear...  36.2  36.2  69%  18  100.00  XM_020819006.2
PREDICTED: Dendrobium catenatum heterogeneous nuclear...  36.2  36.2  69%  18  100.00  XM_020818997.2
Salmo trutta genome assembly, chromosome: 9  36.2  293  69%  18  100.00  LR584409.1  
Echeneis naucrates genome assembly, chromosome: 3  36.2  36.2  69%  18  100.00  LR584044.1  
PREDICTED: Gouania willdenowi acyl-CoA dehydrogenase very long... 36.2  36.2  69%  18  100.00  XM_028474307.1
Mastacembelus armatus genome assembly, chromosome: 18  36.2  36.2  69%  18  100.00  LR535850.1  
Gouania willdenowi genome assembly, chromosome: 24  36.2  36.2  69%  18  100.00  LR131989.1  
Lateolabrax maculatus linkage group 3 sequence  36.2  36.2  69%  18  100.00  CP032600.1  
Lateolabrax maculatus linkage group 15 sequence  36.2  36.2  69%  18  100.00  CP032589.1  
Lateolabrax maculatus chromosome Lm12  36.2  36.2  69%  18  100.00  CP027273.1  
homo sapiens BAC clone VMRC66-509K18 from chromosome 8, comple... 36.2  36.2  69%  18  100.00  AC278041.1  
homo sapiens BAC clone VMRC53-207E6 from chromosome 8, complet... 36.2  36.2  69%  18  100.00  AC278016.1  
homo sapiens BAC clone VMRC53-219K24 from chromosome 8, comple... 36.2  36.2  69%  18  100.00  AC278003.1  
Coregonus sp. 'balchen' genome assembly, chromosome: 33  38.2  621  73%  4.6  100.00  LR778285.1  
Epinephelus fuscoguttatus DNA, LG23, complete sequence  38.2  70.4  73%  4.6  100.00  AP022697.1  
Solanum tuberosum cultivar P8 chromosome 6  38.2  38.2  73%  4.6  100.00  CP046679.1  
Solanum tuberosum cultivar MSH/14-112 chromosome 6  38.2  38.2  73%  4.6  100.00  CP046692.1  
Sciurus vulgaris genome assembly, chromosome: 18  38.2  38.2  73%  4.6  100.00  LR738629.1  
PREDICTED: Gadus morhua uncharacterized LOC115541862...  38.2  38.2  73%  4.6  100.00  XR_003976431.1
Gossypioides kirkii chromosome KI_07  38.2  38.2  73%  4.6  100.00  CP032249.1  
Anabas testudineus genome assembly, chromosome: 5  38.2  38.2  73%  4.6  100.00  LR132035.1  
PREDICTED: Solanum pennellii transcription factor MYB36-like...  38.2  38.2  73%  4.6  100.00  XM_015223362.2
Eukaryotic synthetic construct chromosome 16  38.2  38.2  73%  4.6  100.00  CP034494.1  
PREDICTED: Solanum lycopersicum transcription factor RAX1-like... 38.2  38.2  73%  4.6  100.00  XM_004242053.4
PREDICTED: Python bivittatus retroviral integration site prote... 38.2  38.2  73%  4.6  100.00  XM_025167441.1
PREDICTED: Python bivittatus retroviral integration site prote... 38.2  38.2  73%  4.6  100.00  XM_025167440.1
PREDICTED: Python bivittatus retroviral integration site prote... 38.2  38.2  73%  4.6  100.00  XM_025167439.1
PREDICTED: Python bivittatus retroviral integration site prote... 38.2  38.2  73%  4.6  100.00  XM_025167438.1
PREDICTED: Python bivittatus retroviral integration site prote... 38.2  38.2  73%  4.6  100.00  XM_007429442.2
PREDICTED: Calidris pugnax dynein, axonemal, light intermediat... 38.2  38.2  73%  4.6  100.00  XM_014946460.1
Homo sapiens cDNA FLJ37548 fis, clone BRCAN2027970, moderately... 38.2  38.2  73%  4.6  100.00  AK094867.1  
Zebrafish DNA sequence from clone CH211-254E10 in linkage grou... 38.2  38.2  73%  4.6  100.00  CR352310.15  
Homo sapiens chromosome 16 clone RP11-407G23, complete sequence  38.2  38.2  73%  4.6  100.00  AC009090.12  
Homo sapiens chromosome 16 clone RP11-322D14, complete sequence  38.2  38.2  73%  4.6  100.00  AC023825.8  
PREDICTED: Electrophorus electricus dystroglycan-like...  40.1  40.1  76%  1.2  100.00  XM_027012382.1
Ovis canadensis canadensis isolate 43U chromosome 10 sequence  40.1  74.3  76%  1.2  100.00  CP011895.1  
Crassostrea gigas strain QD chromosome 4  36.2  68.4  76%  18  100.00  CP048842.1  
Streptopelia turtur genome assembly, chromosome: Z  36.2  102  76%  18  100.00  LR594555.1  
PREDICTED: Arachis hypogaea mitochondrial import receptor...  42.1  42.1  80%  0.29  100.00  XM_025757879.2
Bos mutus isolate yakQH1 chromosome 13  42.1  42.1  80%  0.29  100.00  CP027081.1  
Solanum lycopersicum cultivar I-3 chromosome 6  38.2  110  80%  4.6  100.00  CP023762.1  
Solanum lycopersicum chromosome ch06, complete genome  38.2  110  80%  4.6  100.00  HG975518.1  
Solanum pennellii chromosome ch06, complete genome  38.2  72.4  80%  4.6  100.00  HG975445.1  
Echeneis naucrates genome assembly, chromosome: 4  36.2  102  80%  18  100.00  LR584045.1  
Gouania willdenowi genome assembly, chromosome: 18  36.2  68.4  80%  18  100.00  LR131982.1  
Bat coronavirus RaTG13, complete genome  44.1  44.1  84%  0.074100.00  MN996532.1  
PREDICTED: Brassica rapa transcription factor bHLH146...  36.2  36.2  84%  18  95.45  XM_033273128.1
Brassica rapa genome, scaffold: A01  36.2  36.2  84%  18  95.45  LR031571.1  
Gadus morhua genome assembly, chromosome: 4  38.2  108  88%  4.6  100.00  LR633946.1  
Sphaeramia orbicularis genome assembly, chromosome: 11  38.2  38.2  88%  4.6  95.65  LR597468.1  
PREDICTED: Ceratitis capitata uncharacterized LOC101457735...  38.2  38.2  88%  4.6  95.65  XM_004524255.3
Gossypium turneri isolate D10-2 chromosome D10_05  36.2  132  88%  18  95.45  CP032575.1  
Rhinatrema bivittatum genome assembly, chromosome: 15  36.2  68.4  88%  18  100.00  LR584401.1  
Streptopelia turtur genome assembly, chromosome: 5  40.1  176  92%  1.2  95.83  LR594556.1  
Bat SARS-like coronavirus isolate Rs4874, complete genome  40.1  40.1  92%  1.2  95.83  KY417150.1  
Bat SARS-like coronavirus isolate Rs4231, complete genome  40.1  40.1  92%  1.2  95.83  KY417146.1  
SARS-like coronavirus WIV16, complete genome  40.1  40.1  92%  1.2  95.83  KT444582.1  
Salmo trutta genome assembly, chromosome: 7  38.2  553  92%  4.6  100.00  LR584430.1  
Epinephelus fuscoguttatus DNA, LG20, complete sequence  36.2  100  92%  18  100.00  AP022694.1  
Gouania willdenowi genome assembly, chromosome: 12  36.2  68.4  92%  18  95.45  LR132004.1  
Aquila chrysaetos chrysaetos genome assembly, chromosome: 16  38.2  72.4  96%  4.6  100.00  LR606196.1  
Aquila chrysaetos chrysaetos genome assembly, chromosome: Z  38.2  205  96%  4.6  100.00  LR606180.1  
nbr              
             
100.000000            

Alignments; >Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and N genes, complete cds Sequence ID: MT108784.1 Length: 29891 Range 1: 21829 to 21854

Score:52.0 bits(26), Expect:3e-04, Identities:26/26(100%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||||||||||||||||||| Sbjct 21829 TGTTTATTTTGCTTCCACTGAGAAGT 21854

>Bat coronavirus RaTG13, complete genome Sequence ID: MN996532.1 Length: 29855 Range 1: 21815 to 21836

Score:44.1 bits(22), Expect:0.074, Identities:22/22(100%), Gaps:0/22(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTGAGAAGT 26 |||||||||||||||||||||| Sbjct 21815 TATTTTGCTTCCACTGAGAAGT 21836

>PREDICTED: Arachis hypogaea mitochondrial import receptor subunit TOM34 (LOC112706528), mRNA Sequence ID: XM_025757879.2 Length: 2946 Range 1: 2544 to 2564

Score:42.1 bits(21), Expect:0.29, Identities:21/21(100%), Gaps:0/21(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCACTGAG 22 ||||||||||||||||||||| Sbjct 2544 GTTTATTTTGCTTCCACTGAG 2564

>Bos mutus isolate yakQH1 chromosome 13 Sequence ID: CP027081.1 Length: 75983851 Range 1: 63017190 to 63017210

Score:42.1 bits(21), Expect:0.29, Identities:21/21(100%), Gaps:0/21(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTGAGA 23 ||||||||||||||||||||| Sbjct 63017210 TTTATTTTGCTTCCACTGAGA 63017190

>Streptopelia turtur genome assembly, chromosome: 5 Sequence ID: LR594556.1 Length: 70854002 Range 1: 22057117 to 22057140

Score:40.1 bits(20), Expect:1.2, Identities:23/24(96%), Gaps:0/24(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACTGAGAA 24 ||||| |||||||||||||||||| Sbjct 22057140 TGTTTCTTTTGCTTCCACTGAGAA 22057117

Range 2: 31712562 to 31712581

Score:40.1 bits(20), Expect:1.2, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTGAGAA 24 |||||||||||||||||||| Sbjct 31712562 TATTTTGCTTCCACTGAGAA 31712581

Range 3: 41046109 to 41046124

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCC 16 |||||||||||||||| Sbjct 41046109 TGTTTATTTTGCTTCC 41046124

Range 4: 51784512 to 51784527

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 6 ATTTTGCTTCCACTGA 21 |||||||||||||||| Sbjct 51784527 ATTTTGCTTCCACTGA 51784512

Range 5: 55536266 to 55536281

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCA 17 |||||||||||||||| Sbjct 55536266 GTTTATTTTGCTTCCA 55536281

>PREDICTED: Electrophorus electricus dystroglycan-like (LOC113578874), mRNA Sequence ID: XM_027012382.1 Length: 4340 Range 1: 670 to 689

Score:40.1 bits(20), Expect:1.2, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Minus

Query 6 ATTTTGCTTCCACTGAGAAG 25 |||||||||||||||||||| Sbjct 689 ATTTTGCTTCCACTGAGAAG 670

>Bat SARS-like coronavirus isolate Rs4874, complete genome Sequence ID: KY417150.1 Length: 30311 Range 1: 21750 to 21773

Score:40.1 bits(20), Expect:1.2, Identities:23/24(96%), Gaps:0/24(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAA 24 ||||||||||||| |||||||||| Sbjct 21750 TGTTTATTTTGCTGCCACTGAGAA 21773

>Bat SARS-like coronavirus isolate Rs4231, complete genome Sequence ID: KY417146.1 Length: 29782 Range 1: 21750 to 21773

Score:40.1 bits(20), Expect:1.2, Identities:23/24(96%), Gaps:0/24(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAA 24 ||||||||||||| |||||||||| Sbjct 21750 TGTTTATTTTGCTGCCACTGAGAA 21773

>SARS-like coronavirus WIV16, complete genome Sequence ID: KT444582.1 Length: 30290 Range 1: 21749 to 21772

Score:40.1 bits(20), Expect:1.2, Identities:23/24(96%), Gaps:0/24(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAA 24 ||||||||||||| |||||||||| Sbjct 21749 TGTTTATTTTGCTGCCACTGAGAA 21772

>Ovis canadensis canadensis isolate 43U chromosome 10 sequence Sequence ID: CP011895.1 Length: 86551329 Range 1: 31343665 to 31343684

Score:40.1 bits(20), Expect:1.2, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTG 20 |||||||||||||||||||| Sbjct 31343665 TGTTTATTTTGCTTCCACTG 31343684

Range 2: 79815727 to 79815743

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACT 19 ||||||||||||||||| Sbjct 79815727 TTTATTTTGCTTCCACT 79815743

>Coregonus sp. 'balchen' genome assembly, chromosome: 33 Sequence ID: LR778285.1 Length: 44662967 Range 1: 35151455 to 35151473

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCACTG 20 ||||||||||||||||||| Sbjct 35151455 GTTTATTTTGCTTCCACTG 35151473

Range 2: 18701372 to 18701388

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTG 20 ||||||||||||||||| Sbjct 18701388 TTATTTTGCTTCCACTG 18701372

Range 3: 27378703 to 27378719

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTG 20 ||||||||||||||||| Sbjct 27378719 TTATTTTGCTTCCACTG 27378703

Range 4: 13627654 to 13627669

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 13627669 TATTTTGCTTCCACTG 13627654

Range 5: 24298283 to 24298298

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 24298283 TATTTTGCTTCCACTG 24298298

Range 6: 27379038 to 27379053

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 27379038 TATTTTGCTTCCACTG 27379053

Range 7: 31549662 to 31549677

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 31549677 TATTTTGCTTCCACTG 31549662

Range 8: 31550008 to 31550023

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 31550008 TATTTTGCTTCCACTG 31550023

Range 9: 36004909 to 36004924

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 36004909 TATTTTGCTTCCACTG 36004924

Range 10: 36266278 to 36266293

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 36266278 TATTTTGCTTCCACTG 36266293

Range 11: 36407397 to 36407412

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 36407412 TATTTTGCTTCCACTG 36407397

Range 12: 36919023 to 36919038

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 36919023 TATTTTGCTTCCACTG 36919038

Range 13: 37150433 to 37150448

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 37150433 TATTTTGCTTCCACTG 37150448

Range 14: 37388320 to 37388335

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 37388335 TATTTTGCTTCCACTG 37388320

Range 15: 38621057 to 38621072

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 38621057 TATTTTGCTTCCACTG 38621072

Range 16: 39721031 to 39721046

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 39721046 TATTTTGCTTCCACTG 39721031

Range 17: 40823622 to 40823637

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 40823637 TATTTTGCTTCCACTG 40823622

Range 18: 40868289 to 40868304

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 40868289 TATTTTGCTTCCACTG 40868304

Range 19: 44227287 to 44227302

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 44227302 TATTTTGCTTCCACTG 44227287

>Epinephelus fuscoguttatus DNA, LG23, complete sequence Sequence ID: AP022697.1 Length: 36946246 Range 1: 9644683 to 9644701

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 9644701 TTTATTTTGCTTCCACTGA 9644683

Range 2: 14431123 to 14431138

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 6 ATTTTGCTTCCACTGA 21 |||||||||||||||| Sbjct 14431123 ATTTTGCTTCCACTGA 14431138

>Solanum tuberosum cultivar P8 chromosome 6 Sequence ID: CP046679.1 Length: 59524932 Range 1: 55434363 to 55434381

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 55434363 TTTATTTTGCTTCCACTGA 55434381

>Solanum tuberosum cultivar MSH/14-112 chromosome 6 Sequence ID: CP046692.1 Length: 59526227 Range 1: 55436155 to 55436173

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 55436155 TTTATTTTGCTTCCACTGA 55436173

>Sciurus vulgaris genome assembly, chromosome: 18 Sequence ID: LR738629.1 Length: 41577549 Range 1: 14828895 to 14828913

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 14828913 TGTTTATTTTGCTTCCACT 14828895

>PREDICTED: Gadus morhua uncharacterized LOC115541862 (LOC115541862), ncRNA Sequence ID: XR_003976431.1 Length: 1348 Range 1: 1075 to 1093

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 1093 TGTTTATTTTGCTTCCACT 1075

>Gadus morhua genome assembly, chromosome: 4 Sequence ID: LR633946.1 Length: 43798135 Range 1: 36435992 to 36436010

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 36436010 TGTTTATTTTGCTTCCACT 36435992

Range 2: 4745214 to 4745231

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 4 TTATTTTGCTTCCACTGA 21 |||||||||||||||||| Sbjct 4745214 TTATTTTGCTTCCACTGA 4745231

Range 3: 4743546 to 4743562

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGA 23 ||||||||||||||||| Sbjct 4743546 TTTTGCTTCCACTGAGA 4743562

>Aquila chrysaetos chrysaetos genome assembly, chromosome: 16 Sequence ID: LR606196.1 Length: 30610376 Range 1: 811438 to 811456

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAAG 25 ||||||||||||||||||| Sbjct 811438 TTTTGCTTCCACTGAGAAG 811456

Range 2: 29580735 to 29580751

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCA 17 ||||||||||||||||| Sbjct 29580735 TGTTTATTTTGCTTCCA 29580751

>Aquila chrysaetos chrysaetos genome assembly, chromosome: Z Sequence ID: LR606180.1 Length: 88216475 Range 1: 9525440 to 9525458

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 6 ATTTTGCTTCCACTGAGAA 24 ||||||||||||||||||| Sbjct 9525458 ATTTTGCTTCCACTGAGAA 9525440

Range 2: 42679569 to 42679589

Score:34.2 bits(17), Expect:71, Identities:20/21(95%), Gaps:0/21(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAGAA 24 |||||||||||||||| |||| Sbjct 42679589 TTATTTTGCTTCCACTCAGAA 42679569

Range 3: 51907966 to 51907982

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 10 TGCTTCCACTGAGAAGT 26 ||||||||||||||||| Sbjct 51907982 TGCTTCCACTGAGAAGT 51907966

Range 4: 64403322 to 64403338

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCAC 18 ||||||||||||||||| Sbjct 64403322 GTTTATTTTGCTTCCAC 64403338

Range 5: 7324094 to 7324109

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 7 TTTTGCTTCCACTGAG 22 |||||||||||||||| Sbjct 7324109 TTTTGCTTCCACTGAG 7324094

Range 6: 20048958 to 20048973

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 8 TTTGCTTCCACTGAGA 23 |||||||||||||||| Sbjct 20048973 TTTGCTTCCACTGAGA 20048958

>Sphaeramia orbicularis genome assembly, chromosome: 11 Sequence ID: LR597468.1 Length: 56493859 Range 1: 12434746 to 12434768

Score:38.2 bits(19), Expect:4.6, Identities:22/23(96%), Gaps:0/23(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACTGAGA 23 |||||||| |||||||||||||| Sbjct 12434768 TGTTTATTCTGCTTCCACTGAGA 12434746

>Gossypioides kirkii chromosome KI_07 Sequence ID: CP032249.1 Length: 37252039 Range 1: 27778057 to 27778075

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 27778075 TTTATTTTGCTTCCACTGA 27778057

>Salmo trutta genome assembly, chromosome: 7 Sequence ID: LR584430.1 Length: 59837330 Range 1: 44446340 to 44446358

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 GTTTATTTTGCTTCCACTG 20 ||||||||||||||||||| Sbjct 44446358 GTTTATTTTGCTTCCACTG 44446340

Range 2: 4439230 to 4439245

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 4439245 TATTTTGCTTCCACTG 4439230

Range 3: 5874595 to 5874610

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 5874595 TATTTTGCTTCCACTG 5874610

Range 4: 8446751 to 8446766

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 8446751 TATTTTGCTTCCACTG 8446766

Range 5: 9925581 to 9925596

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 9925581 TATTTTGCTTCCACTG 9925596

Range 6: 15858553 to 15858568

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 15858568 TATTTTGCTTCCACTG 15858553

Range 7: 16685827 to 16685842

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 16685842 TATTTTGCTTCCACTG 16685827

Range 8: 17063087 to 17063102

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 17063102 TATTTTGCTTCCACTG 17063087

Range 9: 20138423 to 20138438

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 20138438 TATTTTGCTTCCACTG 20138423

Range 10: 20835052 to 20835067

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 20835052 TATTTTGCTTCCACTG 20835067

Range 11: 24545050 to 24545065

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 24545065 TATTTTGCTTCCACTG 24545050

Range 12: 45378034 to 45378049

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 45378034 TATTTTGCTTCCACTG 45378049

Range 13: 49505225 to 49505240

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 49505225 TATTTTGCTTCCACTG 49505240

Range 14: 51050741 to 51050756

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 10 TGCTTCCACTGAGAAG 25 |||||||||||||||| Sbjct 51050741 TGCTTCCACTGAGAAG 51050756

Range 15: 51201956 to 51201971

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 51201956 TATTTTGCTTCCACTG 51201971

Range 16: 52071158 to 52071173

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 52071158 TATTTTGCTTCCACTG 52071173

Range 17: 53088856 to 53088871

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 53088856 TATTTTGCTTCCACTG 53088871

>Anabas testudineus genome assembly, chromosome: 5 Sequence ID: LR132035.1 Length: 26719370 Range 1: 6400526 to 6400544

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAG 22 ||||||||||||||||||| Sbjct 6400544 TTATTTTGCTTCCACTGAG 6400526

>PREDICTED: Solanum pennellii transcription factor MYB36-like (LOC107022771), mRNA Sequence ID: XM_015223362.2 Length: 1167 Range 1: 1049 to 1067

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 1049 TTTATTTTGCTTCCACTGA 1067

>Eukaryotic synthetic construct chromosome 16 Sequence ID: CP034494.1 Length: 98200793 >Eukaryotic synthetic construct chromosome 16 Sequence ID: CP034519.1 Length: 98200793 Range 1: 57098408 to 57098426

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 57098408 TGTTTATTTTGCTTCCACT 57098426

>PREDICTED: Solanum lycopersicum transcription factor RAX1-like (LOC101260444), mRNA Sequence ID: XM_004242053.4 Length: 1190 Range 1: 1082 to 1100

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 1082 TTTATTTTGCTTCCACTGA 1100

>PREDICTED: Python bivittatus retroviral integration site protein Fli-1 homolog (LOC103052522), transcript variant X5, mRNA Sequence ID: XM_025167441.1 Length: 3987 Range 1: 2739 to 2757

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAG 22 ||||||||||||||||||| Sbjct 2757 TTATTTTGCTTCCACTGAG 2739

>PREDICTED: Python bivittatus retroviral integration site protein Fli-1 homolog (LOC103052522), transcript variant X4, mRNA Sequence ID: XM_025167440.1 Length: 3790 Range 1: 2542 to 2560

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAG 22 ||||||||||||||||||| Sbjct 2560 TTATTTTGCTTCCACTGAG 2542

>PREDICTED: Python bivittatus retroviral integration site protein Fli-1 homolog (LOC103052522), transcript variant X3, mRNA Sequence ID: XM_025167439.1 Length: 3838 Range 1: 2590 to 2608

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAG 22 ||||||||||||||||||| Sbjct 2608 TTATTTTGCTTCCACTGAG 2590

>PREDICTED: Python bivittatus retroviral integration site protein Fli-1 homolog (LOC103052522), transcript variant X2, mRNA Sequence ID: XM_025167438.1 Length: 3838 Range 1: 2590 to 2608

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAG 22 ||||||||||||||||||| Sbjct 2608 TTATTTTGCTTCCACTGAG 2590

>PREDICTED: Python bivittatus retroviral integration site protein Fli-1 homolog (LOC103052522), transcript variant X1, mRNA Sequence ID: XM_007429442.2 Length: 3841 Range 1: 2593 to 2611

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAG 22 ||||||||||||||||||| Sbjct 2611 TTATTTTGCTTCCACTGAG 2593

>Solanum lycopersicum cultivar I-3 chromosome 6 Sequence ID: CP023762.1 Length: 49756038 Range 1: 46420043 to 46420061

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 46420043 TTTATTTTGCTTCCACTGA 46420061

Range 2: 46428832 to 46428850

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 46428832 TTTATTTTGCTTCCACTGA 46428850

Range 3: 45226323 to 45226339

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCA 17 ||||||||||||||||| Sbjct 45226323 TGTTTATTTTGCTTCCA 45226339

>PREDICTED: Ceratitis capitata uncharacterized LOC101457735 (LOC101457735), mRNA Sequence ID: XM_004524255.3 Length: 4563 Range 1: 4186 to 4208

Score:38.2 bits(19), Expect:4.6, Identities:22/23(96%), Gaps:0/23(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTGAGAAG 25 |||||||| |||||||||||||| Sbjct 4208 TTTATTTTACTTCCACTGAGAAG 4186

>PREDICTED: Calidris pugnax dynein, axonemal, light intermediate chain 1 (DNALI1), partial mRNA Sequence ID: XM_014946460.1 Length: 1330 Range 1: 1029 to 1047

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 8 TTTGCTTCCACTGAGAAGT 26 ||||||||||||||||||| Sbjct 1047 TTTGCTTCCACTGAGAAGT 1029

>Solanum lycopersicum chromosome ch06, complete genome Sequence ID: HG975518.1 Length: 46045610 Range 1: 42809492 to 42809510

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 42809492 TTTATTTTGCTTCCACTGA 42809510

Range 2: 42818281 to 42818299

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 42818281 TTTATTTTGCTTCCACTGA 42818299

Range 3: 41615777 to 41615793

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCA 17 ||||||||||||||||| Sbjct 41615777 TGTTTATTTTGCTTCCA 41615793

>Solanum pennellii chromosome ch06, complete genome Sequence ID: HG975445.1 Length: 60730942 Range 1: 57263055 to 57263073

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGA 21 ||||||||||||||||||| Sbjct 57263055 TTTATTTTGCTTCCACTGA 57263073

Range 2: 55969946 to 55969962

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCA 17 ||||||||||||||||| Sbjct 55969946 TGTTTATTTTGCTTCCA 55969962

>Homo sapiens cDNA FLJ37548 fis, clone BRCAN2027970, moderately similar to Homo sapiens copine I mRNA Sequence ID: AK094867.1 Length: 3446 Range 1: 1191 to 1209

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 1191 TGTTTATTTTGCTTCCACT 1209

>Zebrafish DNA sequence from clone CH211-254E10 in linkage group 24, complete sequence Sequence ID: CR352310.15 Length: 181023 Range 1: 26932 to 26950

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 26932 TGTTTATTTTGCTTCCACT 26950

>Homo sapiens chromosome 16 clone RP11-407G23, complete sequence Sequence ID: AC009090.12 Length: 198253 Range 1: 139064 to 139082

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 139082 TGTTTATTTTGCTTCCACT 139064

>Homo sapiens chromosome 16 clone RP11-322D14, complete sequence Sequence ID: AC023825.8 Length: 217521 Range 1: 54750 to 54768

Score:38.2 bits(19), Expect:4.6, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACT 19 ||||||||||||||||||| Sbjct 54768 TGTTTATTTTGCTTCCACT 54750

>Pseudochaenichthys georgianus genome assembly, chromosome: 1 Sequence ID: LR792546.1 Length: 49975704 Range 1: 43935423 to 43935440

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 43935423 TGTTTATTTTGCTTCCAC 43935440

>Canis lupus familiaris breed Labrador retriever chromosome 34a Sequence ID: CP050605.1 Length: 45451182 Range 1: 35547735 to 35547760

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 35547760 TGTTTATTTTCCTGCCACTGAGAAGT 35547735

Range 2: 8564712 to 8564727

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 8564727 TATTTTGCTTCCACTG 8564712

Range 3: 32640988 to 32641007

Score:32.2 bits(16), Expect:281, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAGA 23 ||||||| |||||||||||| Sbjct 32641007 TTATTTTTCTTCCACTGAGA 32640988

>Canis lupus familiaris breed Labrador retriever chromosome 17a Sequence ID: CP050603.1 Length: 64150251 Range 1: 52271382 to 52271399

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 52271382 TTTTGCTTCCACTGAGAA 52271399

Range 2: 12056350 to 12056365

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCAC 18 |||||||||||||||| Sbjct 12056350 TTTATTTTGCTTCCAC 12056365

Range 3: 26034667 to 26034682

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 4 TTATTTTGCTTCCACT 19 |||||||||||||||| Sbjct 26034667 TTATTTTGCTTCCACT 26034682

Range 4: 29326802 to 29326821

Score:32.2 bits(16), Expect:281, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAAGT 26 ||||||||||| |||||||| Sbjct 29326802 TTTTGCTTCCAATGAGAAGT 29326821

Range 5: 46862100 to 46862115

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 6 ATTTTGCTTCCACTGA 21 |||||||||||||||| Sbjct 46862100 ATTTTGCTTCCACTGA 46862115

Range 6: 48725080 to 48725095

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCC 16 |||||||||||||||| Sbjct 48725080 TGTTTATTTTGCTTCC 48725095

>Canis lupus familiaris breed Labrador retriever chromosome 24a Sequence ID: CP050588.1 Length: 47610717 Range 1: 33652427 to 33652444

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 6 ATTTTGCTTCCACTGAGA 23 |||||||||||||||||| Sbjct 33652444 ATTTTGCTTCCACTGAGA 33652427

>Canis lupus familiaris breed Labrador retriever chromosome 08a Sequence ID: CP050567.1 Length: 74671384 Range 1: 42938549 to 42938566

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 8 TTTGCTTCCACTGAGAAG 25 |||||||||||||||||| Sbjct 42938566 TTTGCTTCCACTGAGAAG 42938549

>Canis lupus familiaris breed Labrador retriever chromosome 24b Sequence ID: CP050643.1 Length: 47624915 Range 1: 33664852 to 33664869

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 6 ATTTTGCTTCCACTGAGA 23 |||||||||||||||||| Sbjct 33664869 ATTTTGCTTCCACTGAGA 33664852

>Canis lupus familiaris breed Labrador retriever chromosome 08b Sequence ID: CP050639.1 Length: 74668984 Range 1: 42934707 to 42934724

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 8 TTTGCTTCCACTGAGAAG 25 |||||||||||||||||| Sbjct 42934724 TTTGCTTCCACTGAGAAG 42934707

>Canis lupus familiaris breed Labrador retriever chromosome 17b Sequence ID: CP050614.1 Length: 64169108 Range 1: 52294439 to 52294456

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 52294439 TTTTGCTTCCACTGAGAA 52294456

Range 2: 12061640 to 12061655

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCAC 18 |||||||||||||||| Sbjct 12061640 TTTATTTTGCTTCCAC 12061655

Range 3: 26042580 to 26042595

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 4 TTATTTTGCTTCCACT 19 |||||||||||||||| Sbjct 26042580 TTATTTTGCTTCCACT 26042595

Range 4: 29333032 to 29333051

Score:32.2 bits(16), Expect:281, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAAGT 26 ||||||||||| |||||||| Sbjct 29333032 TTTTGCTTCCAATGAGAAGT 29333051

Range 5: 46892197 to 46892212

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 6 ATTTTGCTTCCACTGA 21 |||||||||||||||| Sbjct 46892197 ATTTTGCTTCCACTGA 46892212

Range 6: 48757565 to 48757580

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCC 16 |||||||||||||||| Sbjct 48757565 TGTTTATTTTGCTTCC 48757580

>Canis lupus familiaris breed Labrador retriever chromosome 34b Sequence ID: CP050608.1 Length: 45430985 Range 1: 35531922 to 35531947

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 35531947 TGTTTATTTTCCTGCCACTGAGAAGT 35531922

Range 2: 8556752 to 8556767

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 8556767 TATTTTGCTTCCACTG 8556752

Range 3: 32616613 to 32616632

Score:32.2 bits(16), Expect:281, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAGA 23 ||||||| |||||||||||| Sbjct 32616632 TTATTTTTCTTCCACTGAGA 32616613

>PREDICTED: Brassica rapa transcription factor bHLH146 (LOC103852863), mRNA Sequence ID: XM_033273128.1 Length: 4080 Range 1: 3741 to 3762

Score:36.2 bits(18), Expect:18, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCACTGAG 22 ||||| |||||||||||||||| Sbjct 3762 TGTTTGTTTTGCTTCCACTGAG 3741

>PREDICTED: Amblyraja radiata cadherin-20-like (LOC116990886), transcript variant X2, mRNA Sequence ID: XM_033049008.1 Length: 3543 Range 1: 1272 to 1289

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 9 TTGCTTCCACTGAGAAGT 26 |||||||||||||||||| Sbjct 1289 TTGCTTCCACTGAGAAGT 1272

>PREDICTED: Amblyraja radiata cadherin-20-like (LOC116990886), transcript variant X1, mRNA Sequence ID: XM_033049001.1 Length: 4664 Range 1: 1271 to 1288

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 9 TTGCTTCCACTGAGAAGT 26 |||||||||||||||||| Sbjct 1288 TTGCTTCCACTGAGAAGT 1271

>Crassostrea gigas strain QD chromosome 4 Sequence ID: CP048842.1 Length: 62642562 Range 1: 47386287 to 47386304

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 47386304 TGTTTATTTTGCTTCCAC 47386287

Range 2: 38492712 to 38492731

Score:32.2 bits(16), Expect:281, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTG 20 ||||||||||||||| |||| Sbjct 38492712 TGTTTATTTTGCTTCTACTG 38492731

>Epinephelus fuscoguttatus DNA, LG20, complete sequence Sequence ID: AP022694.1 Length: 39681369 Range 1: 12736849 to 12736866

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 12736849 TTTTGCTTCCACTGAGAA 12736866

Range 2: 4383838 to 4383853

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCC 16 |||||||||||||||| Sbjct 4383838 TGTTTATTTTGCTTCC 4383853

Range 3: 11760972 to 11760987

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 11760972 TATTTTGCTTCCACTG 11760987

>Candida glabrata strain ATCC 2001 chromosome K Sequence ID: CP048128.1 Length: 1307090 Range 1: 1110063 to 1110080

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 1110063 TGTTTATTTTGCTTCCAC 1110080

>Carnobacterium maltaromaticum strain 18ISCm chromosome, complete genome Sequence ID: CP045040.1 Length: 3582910 Range 1: 1407862 to 1407879

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGA 21 |||||||||||||||||| Sbjct 1407879 TTATTTTGCTTCCACTGA 1407862

>Sciurus carolinensis genome assembly, chromosome: 15 Sequence ID: LR738605.1 Length: 83138899 Range 1: 51812722 to 51812739

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 51812739 TGTTTATTTTGCTTCCAC 51812722

Range 2: 29116609 to 29116624

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCC 16 |||||||||||||||| Sbjct 29116624 TGTTTATTTTGCTTCC 29116609

>Neostethus bicornis genome assembly, chromosome: 8 Sequence ID: LR738556.1 Length: 26260016 Range 1: 6736828 to 6736845

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 6736845 TGTTTATTTTGCTTCCAC 6736828

Range 2: 15402484 to 15402499

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCA 17 |||||||||||||||| Sbjct 15402484 GTTTATTTTGCTTCCA 15402499

>Neostethus bicornis genome assembly, chromosome: 3 Sequence ID: LR738543.1 Length: 34385357 Range 1: 3983706 to 3983723

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 3983723 TGTTTATTTTGCTTCCAC 3983706

>Pecten maximus genome assembly, chromosome: 5 Sequence ID: LR736842.1 Length: 51398101 Range 1: 18797328 to 18797345

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGA 21 |||||||||||||||||| Sbjct 18797345 TTATTTTGCTTCCACTGA 18797328

>PREDICTED: Clupea harengus WD repeat domain 75 (wdr75), mRNA Sequence ID: XM_012842315.2 Length: 3277 Range 1: 85 to 102

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 102 TGTTTATTTTGCTTCCAC 85

>uncultured bacterium partial 16S rRNA gene Sequence ID: LR635228.1 Length: 1481 Range 1: 58 to 75

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 8 TTTGCTTCCACTGAGAAG 25 |||||||||||||||||| Sbjct 58 TTTGCTTCCACTGAGAAG 75

>uncultured bacterium partial 16S rRNA gene Sequence ID: LR645726.1 Length: 1481 Range 1: 58 to 75

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 8 TTTGCTTCCACTGAGAAG 25 |||||||||||||||||| Sbjct 58 TTTGCTTCCACTGAGAAG 75

>Thermosynechococcus sp. CL-1 chromosome, complete genome Sequence ID: CP040671.1 Length: 2647823 Range 1: 105714 to 105731

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTG 20 |||||||||||||||||| Sbjct 105731 TTTATTTTGCTTCCACTG 105714

>PREDICTED: Cannabis sativa pentatricopeptide repeat-containing protein At4g21190 (LOC115716422), transcript variant X4, mRNA Sequence ID: XM_030645212.1 Length: 1097 Range 1: 962 to 979

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 979 TGTTTATTTTGCTTCCAC 962

>PREDICTED: Cannabis sativa pentatricopeptide repeat-containing protein At4g21190 (LOC115716422), transcript variant X3, mRNA Sequence ID: XM_030645211.1 Length: 1312 Range 1: 1177 to 1194

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 1194 TGTTTATTTTGCTTCCAC 1177

>PREDICTED: Cannabis sativa pentatricopeptide repeat-containing protein At4g21190 (LOC115716422), transcript variant X2, mRNA Sequence ID: XM_030645210.1 Length: 1335 Range 1: 1200 to 1217

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 1217 TGTTTATTTTGCTTCCAC 1200

>PREDICTED: Cannabis sativa pentatricopeptide repeat-containing protein At4g21190 (LOC115716422), transcript variant X1, mRNA Sequence ID: XM_030645209.1 Length: 1340 Range 1: 1205 to 1222

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 1222 TGTTTATTTTGCTTCCAC 1205

>Gossypium turneri isolate D10-2 chromosome D10_05 Sequence ID: CP032575.1 Length: 60464062 Range 1: 15967709 to 15967730

Score:36.2 bits(18), Expect:18, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTGAGAA 24 ||||||||||||||| |||||| Sbjct 15967730 TTTATTTTGCTTCCAATGAGAA 15967709

Range 2: 1479914 to 1479929

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCA 17 |||||||||||||||| Sbjct 1479914 GTTTATTTTGCTTCCA 1479929

Range 3: 36812587 to 36812602

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCAC 18 |||||||||||||||| Sbjct 36812602 TTTATTTTGCTTCCAC 36812587

Range 4: 37686218 to 37686233

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 6 ATTTTGCTTCCACTGA 21 |||||||||||||||| Sbjct 37686218 ATTTTGCTTCCACTGA 37686233

>Sphaeramia orbicularis genome assembly, chromosome: 17 Sequence ID: LR597474.1 Length: 57836085 Range 1: 26719627 to 26719644

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 4 TTATTTTGCTTCCACTGA 21 |||||||||||||||||| Sbjct 26719627 TTATTTTGCTTCCACTGA 26719644

>Microcaecilia unicolor genome assembly, chromosome: 14 Sequence ID: LR594645.1 Length: 56647458 Range 1: 44748614 to 44748631

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTG 20 |||||||||||||||||| Sbjct 44748631 TTTATTTTGCTTCCACTG 44748614

>Streptopelia turtur genome assembly, chromosome: Z Sequence ID: LR594555.1 Length: 73908008 Range 1: 42480285 to 42480302

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGA 21 |||||||||||||||||| Sbjct 42480302 TTATTTTGCTTCCACTGA 42480285

Range 2: 42903940 to 42903956

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 4 TTATTTTGCTTCCACTG 20 ||||||||||||||||| Sbjct 42903940 TTATTTTGCTTCCACTG 42903956

Range 3: 7364404 to 7364419

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 8 TTTGCTTCCACTGAGA 23 |||||||||||||||| Sbjct 7364404 TTTGCTTCCACTGAGA 7364419

>PREDICTED: Dendrobium catenatum heterogeneous nuclear ribonucleoprotein R (LOC110093933), transcript variant X2, mRNA Sequence ID: XM_020819006.2 Length: 2864 Range 1: 2661 to 2678

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 8 TTTGCTTCCACTGAGAAG 25 |||||||||||||||||| Sbjct 2661 TTTGCTTCCACTGAGAAG 2678

>PREDICTED: Dendrobium catenatum heterogeneous nuclear ribonucleoprotein R (LOC110093933), transcript variant X1, mRNA Sequence ID: XM_020818997.2 Length: 2785 Range 1: 2582 to 2599

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 8 TTTGCTTCCACTGAGAAG 25 |||||||||||||||||| Sbjct 2582 TTTGCTTCCACTGAGAAG 2599

>Salmo trutta genome assembly, chromosome: 9 Sequence ID: LR584409.1 Length: 49359203 Range 1: 27135741 to 27135758

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 4 TTATTTTGCTTCCACTGA 21 |||||||||||||||||| Sbjct 27135741 TTATTTTGCTTCCACTGA 27135758

Range 2: 4136040 to 4136055

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 4136055 TATTTTGCTTCCACTG 4136040

Range 3: 4548267 to 4548282

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 4548267 TATTTTGCTTCCACTG 4548282

Range 4: 11105598 to 11105613

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 11105613 TATTTTGCTTCCACTG 11105598

Range 5: 12010326 to 12010341

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 12010326 TATTTTGCTTCCACTG 12010341

Range 6: 26303034 to 26303049

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 26303034 TATTTTGCTTCCACTG 26303049

Range 7: 38907043 to 38907058

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 38907043 TATTTTGCTTCCACTG 38907058

Range 8: 39558538 to 39558553

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 39558553 TATTTTGCTTCCACTG 39558538

Range 9: 41891009 to 41891024

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 TATTTTGCTTCCACTG 20 |||||||||||||||| Sbjct 41891009 TATTTTGCTTCCACTG 41891024

>Rhinatrema bivittatum genome assembly, chromosome: 15 Sequence ID: LR584401.1 Length: 80992113 Range 1: 22432000 to 22432017

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 22432000 TGTTTATTTTGCTTCCAC 22432017

Range 2: 16123208 to 16123227

Score:32.2 bits(16), Expect:281, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTGAGA 23 |||||||| ||||||||||| Sbjct 16123227 TTATTTTGTTTCCACTGAGA 16123208

>Echeneis naucrates genome assembly, chromosome: 4 Sequence ID: LR584045.1 Length: 24574459 Range 1: 4319465 to 4319482

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCACT 19 |||||||||||||||||| Sbjct 4319465 GTTTATTTTGCTTCCACT 4319482

Range 2: 21881286 to 21881302

Score:34.2 bits(17), Expect:71, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 4 TTATTTTGCTTCCACTG 20 ||||||||||||||||| Sbjct 21881302 TTATTTTGCTTCCACTG 21881286

Range 3: 21533494 to 21533513

Score:32.2 bits(16), Expect:281, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTGAG 22 |||||||||| ||||||||| Sbjct 21533494 TTTATTTTGCATCCACTGAG 21533513

>Echeneis naucrates genome assembly, chromosome: 3 Sequence ID: LR584044.1 Length: 28058824 Range 1: 20825078 to 20825095

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTTATTTTGCTTCCACTG 20 |||||||||||||||||| Sbjct 20825078 TTTATTTTGCTTCCACTG 20825095

>PREDICTED: Gouania willdenowi acyl-CoA dehydrogenase very long chain (acadvl), mRNA Sequence ID: XM_028474307.1 Length: 2530 Range 1: 889 to 906

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 6 ATTTTGCTTCCACTGAGA 23 |||||||||||||||||| Sbjct 906 ATTTTGCTTCCACTGAGA 889

>Mastacembelus armatus genome assembly, chromosome: 18 Sequence ID: LR535850.1 Length: 19675934 Range 1: 10431286 to 10431303

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCACTG 20 |||||||||||||||||| Sbjct 10431303 TTTATTTTGCTTCCACTG 10431286

>Gouania willdenowi genome assembly, chromosome: 12 Sequence ID: LR132004.1 Length: 33478699 Range 1: 29723684 to 29723705

Score:36.2 bits(18), Expect:18, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 2 GTTTATTTTGCTTCCACTGAGA 23 |||||||||||| ||||||||| Sbjct 29723684 GTTTATTTTGCTCCCACTGAGA 29723705

Range 2: 18744500 to 18744515

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 10 TGCTTCCACTGAGAAG 25 |||||||||||||||| Sbjct 18744515 TGCTTCCACTGAGAAG 18744500

>Gouania willdenowi genome assembly, chromosome: 24 Sequence ID: LR131989.1 Length: 25951273 Range 1: 18280032 to 18280049

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 TGTTTATTTTGCTTCCAC 18 |||||||||||||||||| Sbjct 18280049 TGTTTATTTTGCTTCCAC 18280032

>Gouania willdenowi genome assembly, chromosome: 18 Sequence ID: LR131982.1 Length: 28478336 Range 1: 10036248 to 10036265

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 6 ATTTTGCTTCCACTGAGA 23 |||||||||||||||||| Sbjct 10036265 ATTTTGCTTCCACTGAGA 10036248

Range 2: 13228089 to 13228104

Score:32.2 bits(16), Expect:281, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 3 TTTATTTTGCTTCCAC 18 |||||||||||||||| Sbjct 13228104 TTTATTTTGCTTCCAC 13228089

>Brassica rapa genome, scaffold: A01 Sequence ID: LR031571.1 Length: 37915545 Range 1: 3528884 to 3528905

Score:36.2 bits(18), Expect:18, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAG 22 ||||| |||||||||||||||| Sbjct 3528884 TGTTTGTTTTGCTTCCACTGAG 3528905

>Lateolabrax maculatus linkage group 3 sequence Sequence ID: CP032600.1 Length: 29073605 Range 1: 12749916 to 12749933

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 5 TATTTTGCTTCCACTGAG 22 |||||||||||||||||| Sbjct 12749933 TATTTTGCTTCCACTGAG 12749916

>Lateolabrax maculatus linkage group 15 sequence Sequence ID: CP032589.1 Length: 23369250 Range 1: 3445648 to 3445665

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 3445665 TTTTGCTTCCACTGAGAA 3445648

>Lateolabrax maculatus chromosome Lm12 Sequence ID: CP027273.1 Length: 23523986 Range 1: 12934783 to 12934800

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 12934783 TTTTGCTTCCACTGAGAA 12934800

>homo sapiens BAC clone VMRC66-509K18 from chromosome 8, complete sequence Sequence ID: AC278041.1 Length: 164228 Range 1: 23434 to 23451

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 23451 TTTTGCTTCCACTGAGAA 23434

>homo sapiens BAC clone VMRC53-207E6 from chromosome 8, complete sequence Sequence ID: AC278016.1 Length: 173057 Range 1: 169009 to 169026

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 169009 TTTTGCTTCCACTGAGAA 169026

>homo sapiens BAC clone VMRC53-219K24 from chromosome 8, complete sequence Sequence ID: AC278003.1 Length: 161996 Range 1: 125339 to 125356

Score:36.2 bits(18), Expect:18, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTTTGCTTCCACTGAGAA 24 |||||||||||||||||| Sbjct 125339 TTTTGCTTCCACTGAGAA 125356

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X15, mRNA Sequence ID: XM_025425478.1 Length: 2292 Range 1: 1062 to 1087

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1062 TGTTTATTTTCCTGCCACTGAGAAGT 1087

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X13, misc_RNA Sequence ID: XR_003127332.1 Length: 2299 Range 1: 1458 to 1483

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1458 TGTTTATTTTCCTGCCACTGAGAAGT 1483

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X12, misc_RNA Sequence ID: XR_003127331.1 Length: 2359 Range 1: 1458 to 1483

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1458 TGTTTATTTTCCTGCCACTGAGAAGT 1483

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X11, misc_RNA Sequence ID: XR_003127330.1 Length: 2361 Range 1: 1458 to 1483

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1458 TGTTTATTTTCCTGCCACTGAGAAGT 1483

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X10, misc_RNA Sequence ID: XR_003127329.1 Length: 2357 Range 1: 1458 to 1483

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1458 TGTTTATTTTCCTGCCACTGAGAAGT 1483

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X9, misc_RNA Sequence ID: XR_003127328.1 Length: 2362 Range 1: 1458 to 1483

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1458 TGTTTATTTTCCTGCCACTGAGAAGT 1483

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X8, mRNA Sequence ID: XM_025425476.1 Length: 2683 Range 1: 1453 to 1478

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1453 TGTTTATTTTCCTGCCACTGAGAAGT 1478

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X7, mRNA Sequence ID: XM_025425475.1 Length: 2621 Range 1: 1391 to 1416

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1391 TGTTTATTTTCCTGCCACTGAGAAGT 1416

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X6, mRNA Sequence ID: XM_025425474.1 Length: 2307 Range 1: 1458 to 1483

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1458 TGTTTATTTTCCTGCCACTGAGAAGT 1483

>PREDICTED: Canis lupus dingo zinc finger B-box domain containing (ZBBX), transcript variant X5, mRNA Sequence ID: XM_025425473.1 Length: 2310 Range 1: 1458 to 1483

Score:36.2 bits(18), Expect:18, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 TGTTTATTTTGCTTCCACTGAGAAGT 26 |||||||||| || |||||||||||| Sbjct 1458 TGTTTATTTTCCTGCCACTGAGAAGT 1483