Afwfkydw016 alignment txt

créé le: 20200428
mis à jour le: 20200428
généré le:20200525_110106

Region HIV1b 213-244: HIV-1 isolate 4045_Plasma_Visit1_amplicon5a from Malawi envelope glycoprotein (env) gene, complete cds Sequence ID: KC187063.1Length: 2547Number of Matches: 1 CCCTACTTATTGTTAATAACGCTACTAATGTT

RID: AFWFKYDW016 Job Title:Nucleotide Sequence Program: BLASTN Database: nt Nucleotide collection (nt) Query #1: Query ID: lcl|Query_885 Length: 32

Sequences producing significant alignments:

 Max  TotalQueryE  Per.    
Description  ScoreScorecoverValueIdent Accession  
Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 63.9  63.9  100%  2e-07100.00  MT108784.1  
Proteus mirabilis strain STP3 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP051260.1  
Proteus mirabilis strain XH1569 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP049942.1  
Proteus mirabilis strain XH1568 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP049941.1  
Proteus mirabilis strain PmBR607 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP049753.1  
Proteus mirabilis strain ZA25 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP047352.1  
Proteus mirabilis strain 1701092 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP042857.1  
Proteus mirabilis strain CC15031 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP048787.1  
Aphantopus hyperantus genome assembly, chromosome: 1  36.2  36.2  56%  40  100.00  LR761647.1  
Proteus mirabilis strain N18-00201 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP048404.1  
Proteus mirabilis strain SCBX1.1 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP047112.1  
Proteus mirabilis strain CRE14IB chromosome, complete genome  36.2  36.2  56%  40  100.00  CP045538.2  
Pecten maximus genome assembly, chromosome: 11  36.2  36.2  56%  40  100.00  LR736848.1  
Proteus mirabilis strain ENT1224 chromosome  36.2  36.2  56%  40  100.00  CP044134.1  
Proteus mirabilis strain ENT1157 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP044136.1  
Proteus mirabilis strain ENT1301 chromosome  36.2  36.2  56%  40  100.00  CP044135.1  
Caligus rogercresseyi isolate FCH chromosome 16  36.2  36.2  56%  40  100.00  CP045905.1  
Proteus mirabilis strain K817 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP044028.1  
Proteus mirabilis strain S1959 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP043870.1  
Proteus mirabilis strain CRPM10 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP043332.1  
Proteus mirabilis strain VAC chromosome, complete genome  36.2  36.2  56%  40  100.00  CP042907.1  
Mucilaginibacter ginsenosidivorans strain Gsoil 3017 chromosom... 36.2  36.2  56%  40  100.00  CP042436.1  
Proteus mirabilis strain CLPM181223 chromosome  36.2  36.2  56%  40  100.00  CP041391.1  
Myripristis murdjan genome assembly, chromosome: 6  36.2  36.2  56%  40  100.00  LR597555.1  
PREDICTED: Osmia bicornis bicornis cysteine-rich protein 1-lik... 36.2  36.2  56%  40  100.00  XM_029190245.1
Proteus mirabilis strain PmSC1111 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP034090.1  
Proteus mirabilis strain PmBC1123 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP034091.1  
PREDICTED: Ooceraea biroi uncharacterized LOC105286741...  36.2  36.2  56%  40  100.00  XR_895306.2  
PREDICTED: Rhopalosiphum maidis probable...  36.2  36.2  56%  40  100.00  XM_026957090.1
PREDICTED: Rhopalosiphum maidis probable...  36.2  36.2  56%  40  100.00  XM_026957089.1
PREDICTED: Trichoplusia ni protein shuttle craft (LOC113492111... 36.2  36.2  56%  40  100.00  XM_026869428.1
Bacillus litoralis strain Bac94 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP033043.1  
Proteus mirabilis strain NCTC4199 genome assembly, chromosome: 1  36.2  36.2  56%  40  100.00  LR134205.1  
PREDICTED: Solanum lycopersicum beta-amyrin...  36.2  36.2  56%  40  100.00  XM_004228912.4
Proteus mirabilis strain AR_0029 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP029725.1  
PREDICTED: Pomacea canaliculata toll-like receptor 13...  36.2  36.2  56%  40  100.00  XM_025252572.1
Proteus mirabilis strain CCUG 70746 chromosome  36.2  36.2  56%  40  100.00  CP023273.1  
Bacillus cytotoxicus strain CH_1 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024120.1  
Bacillus cytotoxicus strain CH_2 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024116.1  
Bacillus cytotoxicus strain CH_3 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024113.1  
Bacillus cytotoxicus strain CH_4 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024111.1  
Bacillus cytotoxicus strain CH_13 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024109.1  
Bacillus cytotoxicus strain CH_15 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024107.1  
Bacillus cytotoxicus strain CH_23 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024104.1  
Bacillus cytotoxicus strain CH_25 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024101.1  
Bacillus cytotoxicus strain CH_38 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024098.1  
Bacillus cytotoxicus strain CH_39 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP024096.1  
Proteus mirabilis strain AR379 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP029133.1  
Proteus mirabilis strain K1609 chromosome  36.2  36.2  56%  40  100.00  CP028522.1  
Proteus mirabilis strain K670 chromosome  36.2  36.2  56%  40  100.00  CP028356.1  
Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP026051.1  
Proteus mirabilis isolate GN2 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP026581.1  
Proteus mirabilis strain BC11-24 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP026571.1  
PREDICTED: Lactuca sativa gamma-glutamyl hydrolase 2-like...  36.2  36.2  56%  40  100.00  XM_023909608.1
Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP026062.1  
Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP026044.1  
Solanum lycopersicum cultivar I-3 chromosome 1  36.2  36.2  56%  40  100.00  CP023757.1  
Yersinia frederiksenii strain FDAARGOS_417 chromosome, complet... 36.2  36.2  56%  40  100.00  CP023962.1  
Proteus mirabilis strain T18 chromosome, complete genome  36.2  36.2  56%  40  100.00  CP017085.1  
Proteus mirabilis strain T21, complete genome  36.2  36.2  56%  40  100.00  CP017082.1  
Proteus mirabilis strain AR_0156, complete genome  36.2  36.2  56%  40  100.00  CP021852.1  
Proteus mirabilis strain AR_0159, complete genome  36.2  36.2  56%  40  100.00  CP021550.1  
Proteus mirabilis strain AR_0059, complete genome  36.2  36.2  56%  40  100.00  CP020052.1  
PREDICTED: Musca domestica transcription factor collier...  38.2  38.2  59%  10  100.00  XM_020040004.1
PREDICTED: Dendroctonus ponderosae homeotic protein...  38.2  38.2  59%  10  100.00  XM_019905362.1
PREDICTED: Dendroctonus ponderosae homeotic protein...  38.2  38.2  59%  10  100.00  XM_019905361.1
Cucumis melo genomic chromosome, chr_11  38.2  38.2  59%  10  100.00  LN713265.1  
Cucumis melo genomic scaffold, anchoredscaffold00039  38.2  38.2  59%  10  100.00  LN681921.1  
Epinephelus fuscoguttatus DNA, LG13, complete sequence  40.1  40.1  62%  2.5  100.00  AP022687.1  
Apteryx australis mantelli genome assembly AptMant0, scaffold...  40.1  40.1  62%  2.5  100.00  LK064655.1  
PREDICTED: Trachymyrmex zeteki esterase E4-like (LOC108731302)... 42.1  42.1  65%  0.64  100.00  XM_018461558.1
PREDICTED: Trachymyrmex zeteki esterase E4-like (LOC108731302)... 42.1  42.1  65%  0.64  100.00  XM_018461557.1
Clostridium pasteurianum strain M150B, complete genome  44.1  44.1  68%  0.16  100.00  CP013019.1  
Clostridium pasteurianum DSM 525 = ATCC 6013, complete genome  44.1  44.1  68%  0.16  100.00  CP013018.1  
Clostridium pasteurianum DSM 525 = ATCC 6013, complete genome  44.1  44.1  68%  0.16  100.00  CP009268.1  
Clostridium pasteurianum DSM 525 = ATCC 6013, complete genome  44.1  44.1  68%  0.16  100.00  CP009267.1  
C.pasteurianum gene for ferredoxin  44.1  44.1  68%  0.16  100.00  Z19005.1  
Pseudochaenichthys georgianus genome assembly, chromosome: 3  36.2  36.2  68%  40  95.45  LR792548.1  
Acidianus sulfidivorans JP7 chromosome, complete genome  36.2  36.2  68%  40  95.45  CP029288.2  
PREDICTED: Oreochromis aureus uncharacterized LOC116328903...  36.2  36.2  68%  40  95.45  XR_004200122.1
PREDICTED: Oreochromis aureus uncharacterized LOC116316373...  36.2  36.2  68%  40  95.45  XR_004199156.1
Helicobacter pylori TN2wt DNA, complete genome  36.2  68.4  68%  40  95.45  AP019730.1  
Pan troglodytes chromosome 2 clone CH251-60P06, complete sequence36.2  36.2  68%  40  95.45  AC279084.1  
Pan troglodytes chromosome 2 clone CH251-17O22, complete sequence36.2  36.2  68%  40  95.45  AC278930.1  
Pan troglodytes chromosome 2 clone CH251-108A24, complete...  36.2  36.2  68%  40  95.45  AC278921.1  
Helicobacter pylori strain Hpbs1 chromosome, complete genome  36.2  36.2  68%  40  95.45  CP034071.1  
Eukaryotic synthetic construct chromosome 21  36.2  36.2  68%  40  95.45  CP034500.1  
PREDICTED: Durio zibethinus universal stress protein PHOS32-li... 36.2  36.2  68%  40  95.45  XM_022877387.1
Agarilytica rhodophyticola strain 017 chromosome, complete genome36.2  36.2  68%  40  95.45  CP020038.1  
Homo sapiens BAC clone CH17-289H4 from chromosome 9, complete...  36.2  36.2  68%  40  95.45  AC275593.1  
Canis lupus familiaris breed Labrador retriever chromosome 34a  38.2  38.2  71%  10  95.65  CP050605.1  
Canis lupus familiaris breed Labrador retriever chromosome 34b  38.2  38.2  71%  10  95.65  CP050608.1  
Solanum tuberosum cultivar MSH/14-112 chromosome 1  36.2  68.4  81%  40  100.00  CP046702.1  
PREDICTED: Tetranychus urticae dopamine receptor 2-like...  36.2  36.2  81%  40  92.31  XM_025161470.1
Solanum tuberosum cultivar P8 chromosome 1  32.2  96.6  81%  618  95.00  CP046688.1  
Epinephelus fuscoguttatus DNA, LG3, complete sequence  36.2  68.4  84%  40  100.00  AP022677.1  
Bat coronavirus RaTG13, complete genome  60.0  60.0  93%  3e-06100.00  MN996532.1  
Canis lupus familiaris breed Labrador retriever chromosome 24a  36.2  100  96%  40  100.00  CP050588.1  
Canis lupus familiaris breed Labrador retriever chromosome 24b  36.2  100  96%  40  100.00  CP050643.1  
Aphantopus hyperantus genome assembly, chromosome: 16  36.2  68.4  96%  40  95.45  LR761663.1  
nbr              
             
100.000000            

Alignments: >Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and N genes, complete cds Sequence ID: MT108784.1 Length: 29891 Range 1: 21909 to 21940

Score:63.9 bits(32), Expect:2e-07, Identities:32/32(100%), Gaps:0/32(0%), Strand: Plus/Plus

Query 1 CCCTACTTATTGTTAATAACGCTACTAATGTT 32 |||||||||||||||||||||||||||||||| Sbjct 21909 CCCTACTTATTGTTAATAACGCTACTAATGTT 21940

>Bat coronavirus RaTG13, complete genome Sequence ID: MN996532.1 Length: 29855 Range 1: 21893 to 21922

Score:60.0 bits(30), Expect:3e-06, Identities:30/30(100%), Gaps:0/30(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAACGCTACTAATGTT 32 |||||||||||||||||||||||||||||| Sbjct 21893 CTACTTATTGTTAATAACGCTACTAATGTT 21922

>Clostridium pasteurianum strain M150B, complete genome Sequence ID: CP013019.1 Length: 4351863 Range 1: 1511990 to 1512011

Score:44.1 bits(22), Expect:0.16, Identities:22/22(100%), Gaps:0/22(0%), Strand: Plus/Minus

Query 8 TATTGTTAATAACGCTACTAAT 29 |||||||||||||||||||||| Sbjct 1512011 TATTGTTAATAACGCTACTAAT 1511990

>Clostridium pasteurianum DSM 525 = ATCC 6013, complete genome Sequence ID: CP013018.1 Length: 4352852 Range 1: 1512955 to 1512976

Score:44.1 bits(22), Expect:0.16, Identities:22/22(100%), Gaps:0/22(0%), Strand: Plus/Minus

Query 8 TATTGTTAATAACGCTACTAAT 29 |||||||||||||||||||||| Sbjct 1512976 TATTGTTAATAACGCTACTAAT 1512955

>Clostridium pasteurianum DSM 525 = ATCC 6013, complete genome Sequence ID: CP009268.1 Length: 4352101 Range 1: 1511994 to 1512015

Score:44.1 bits(22), Expect:0.16, Identities:22/22(100%), Gaps:0/22(0%), Strand: Plus/Minus

Query 8 TATTGTTAATAACGCTACTAAT 29 |||||||||||||||||||||| Sbjct 1512015 TATTGTTAATAACGCTACTAAT 1511994

>Clostridium pasteurianum DSM 525 = ATCC 6013, complete genome Sequence ID: CP009267.1 Length: 4351893 Range 1: 1511994 to 1512015

Score:44.1 bits(22), Expect:0.16, Identities:22/22(100%), Gaps:0/22(0%), Strand: Plus/Minus

Query 8 TATTGTTAATAACGCTACTAAT 29 |||||||||||||||||||||| Sbjct 1512015 TATTGTTAATAACGCTACTAAT 1511994

>C.pasteurianum gene for ferredoxin Sequence ID: Z19005.1 Length: 1348 Range 1: 379 to 400

Score:44.1 bits(22), Expect:0.16, Identities:22/22(100%), Gaps:0/22(0%), Strand: Plus/Plus

Query 8 TATTGTTAATAACGCTACTAAT 29 |||||||||||||||||||||| Sbjct 379 TATTGTTAATAACGCTACTAAT 400

>PREDICTED: Trachymyrmex zeteki esterase E4-like (LOC108731302), transcript variant X2, mRNA Sequence ID: XM_018461558.1 Length: 2715 Range 1: 1900 to 1920

Score:42.1 bits(21), Expect:0.64, Identities:21/21(100%), Gaps:0/21(0%), Strand: Plus/Plus

Query 4 TACTTATTGTTAATAACGCTA 24 ||||||||||||||||||||| Sbjct 1900 TACTTATTGTTAATAACGCTA 1920

>PREDICTED: Trachymyrmex zeteki esterase E4-like (LOC108731302), transcript variant X1, mRNA Sequence ID: XM_018461557.1 Length: 2653 Range 1: 1838 to 1858

Score:42.1 bits(21), Expect:0.64, Identities:21/21(100%), Gaps:0/21(0%), Strand: Plus/Plus

Query 4 TACTTATTGTTAATAACGCTA 24 ||||||||||||||||||||| Sbjct 1838 TACTTATTGTTAATAACGCTA 1858

>Epinephelus fuscoguttatus DNA, LG13, complete sequence Sequence ID: AP022687.1 Length: 43720812 Range 1: 13898334 to 13898353

Score:40.1 bits(20), Expect:2.5, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Plus

Query 6 CTTATTGTTAATAACGCTAC 25 |||||||||||||||||||| Sbjct 13898334 CTTATTGTTAATAACGCTAC 13898353

>Apteryx australis mantelli genome assembly AptMant0, scaffold scaffold71 Sequence ID: LK064655.1 Length: 14936771 Range 1: 14081545 to 14081564

Score:40.1 bits(20), Expect:2.5, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Minus

Query 13 TTAATAACGCTACTAATGTT 32 |||||||||||||||||||| Sbjct 14081564 TTAATAACGCTACTAATGTT 14081545

>Canis lupus familiaris breed Labrador retriever chromosome 34a Sequence ID: CP050605.1 Length: 45451182 Range 1: 26013884 to 26013906

Score:38.2 bits(19), Expect:10, Identities:22/23(96%), Gaps:0/23(0%), Strand: Plus/Minus

Query 8 TATTGTTAATAACGCTACTAATG 30 |||||||||||| |||||||||| Sbjct 26013906 TATTGTTAATAATGCTACTAATG 26013884

>Canis lupus familiaris breed Labrador retriever chromosome 34b Sequence ID: CP050608.1 Length: 45430985 Range 1: 26007128 to 26007150

Score:38.2 bits(19), Expect:10, Identities:22/23(96%), Gaps:0/23(0%), Strand: Plus/Minus

Query 8 TATTGTTAATAACGCTACTAATG 30 |||||||||||| |||||||||| Sbjct 26007150 TATTGTTAATAATGCTACTAATG 26007128

>PREDICTED: Musca domestica transcription factor collier (LOC101900301), mRNA Sequence ID: XM_020040004.1 Length: 2193 Range 1: 2032 to 2050

Score:38.2 bits(19), Expect:10, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CCTACTTATTGTTAATAAC 20 ||||||||||||||||||| Sbjct 2050 CCTACTTATTGTTAATAAC 2032

>PREDICTED: Dendroctonus ponderosae homeotic protein ultrabithorax-like (LOC109538215), transcript variant X2, mRNA Sequence ID: XM_019905362.1 Length: 4019 Range 1: 3412 to 3430

Score:38.2 bits(19), Expect:10, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAACG 21 ||||||||||||||||||| Sbjct 3412 CTACTTATTGTTAATAACG 3430

>PREDICTED: Dendroctonus ponderosae homeotic protein ultrabithorax-like (LOC109538215), transcript variant X1, mRNA Sequence ID: XM_019905361.1 Length: 4031 Range 1: 3424 to 3442

Score:38.2 bits(19), Expect:10, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAACG 21 ||||||||||||||||||| Sbjct 3424 CTACTTATTGTTAATAACG 3442

>Cucumis melo genomic chromosome, chr_11 Sequence ID: LN713265.1 Length: 31442130 Range 1: 23991291 to 23991309

Score:38.2 bits(19), Expect:10, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 CCCTACTTATTGTTAATAA 19 ||||||||||||||||||| Sbjct 23991309 CCCTACTTATTGTTAATAA 23991291

>Cucumis melo genomic scaffold, anchoredscaffold00039 Sequence ID: LN681921.1 Length: 3654998 Range 1: 2871958 to 2871976

Score:38.2 bits(19), Expect:10, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 CCCTACTTATTGTTAATAA 19 ||||||||||||||||||| Sbjct 2871976 CCCTACTTATTGTTAATAA 2871958

>Proteus mirabilis strain STP3 chromosome, complete genome Sequence ID: CP051260.1 Length: 4115975 Range 1: 2085775 to 2085792

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2085792 TTATTGTTAATAACGCTA 2085775

>Pseudochaenichthys georgianus genome assembly, chromosome: 3 Sequence ID: LR792548.1 Length: 53425585 Range 1: 17446736 to 17446757

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 2 CCTACTTATTGTTAATAACGCT 23 ||||||||||||||| |||||| Sbjct 17446736 CCTACTTATTGTTAAAAACGCT 17446757

>Canis lupus familiaris breed Labrador retriever chromosome 24a Sequence ID: CP050588.1 Length: 47610717 Range 1: 21033798 to 21033815

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAAC 20 |||||||||||||||||| Sbjct 21033798 CTACTTATTGTTAATAAC 21033815

Range 2: 6694679 to 6694694

Score:32.2 bits(16), Expect:618, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 2 CCTACTTATTGTTAAT 17 |||||||||||||||| Sbjct 6694679 CCTACTTATTGTTAAT 6694694

Range 3: 7902388 to 7902407

Score:32.2 bits(16), Expect:618, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Minus

Query 13 TTAATAACGCTACTAATGTT 32 ||||||| |||||||||||| Sbjct 7902407 TTAATAAGGCTACTAATGTT 7902388

>Canis lupus familiaris breed Labrador retriever chromosome 24b Sequence ID: CP050643.1 Length: 47624915 Range 1: 21054874 to 21054891

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAAC 20 |||||||||||||||||| Sbjct 21054874 CTACTTATTGTTAATAAC 21054891

Range 2: 6696587 to 6696602

Score:32.2 bits(16), Expect:618, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 2 CCTACTTATTGTTAAT 17 |||||||||||||||| Sbjct 6696587 CCTACTTATTGTTAAT 6696602

Range 3: 7909536 to 7909555

Score:32.2 bits(16), Expect:618, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Minus

Query 13 TTAATAACGCTACTAATGTT 32 ||||||| |||||||||||| Sbjct 7909555 TTAATAAGGCTACTAATGTT 7909536

>Proteus mirabilis strain XH1569 chromosome, complete genome Sequence ID: CP049942.1 Length: 3998116 Range 1: 2075738 to 2075755

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2075755 TTATTGTTAATAACGCTA 2075738

>Proteus mirabilis strain XH1568 chromosome, complete genome Sequence ID: CP049941.1 Length: 4012915 Range 1: 1985754 to 1985771

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1985771 TTATTGTTAATAACGCTA 1985754

>Proteus mirabilis strain PmBR607 chromosome, complete genome Sequence ID: CP049753.1 Length: 4075803 Range 1: 2998014 to 2998031

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2998014 TTATTGTTAATAACGCTA 2998031

>Acidianus sulfidivorans JP7 chromosome, complete genome Sequence ID: CP029288.2 Length: 2265309 Range 1: 2194951 to 2194972

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 11 TGTTAATAACGCTACTAATGTT 32 ||||||||||| |||||||||| Sbjct 2194951 TGTTAATAACGTTACTAATGTT 2194972

>Proteus mirabilis strain ZA25 chromosome, complete genome Sequence ID: CP047352.1 Length: 3937098 Range 1: 2026627 to 2026644

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2026644 TTATTGTTAATAACGCTA 2026627

>Proteus mirabilis strain 1701092 chromosome, complete genome Sequence ID: CP042857.1 Length: 4131513 Range 1: 2042247 to 2042264

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2042264 TTATTGTTAATAACGCTA 2042247

>Epinephelus fuscoguttatus DNA, LG3, complete sequence Sequence ID: AP022677.1 Length: 48981850 Range 1: 23014946 to 23014963

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 13 TTAATAACGCTACTAATG 30 |||||||||||||||||| Sbjct 23014963 TTAATAACGCTACTAATG 23014946

Range 2: 12323962 to 12323977

Score:32.2 bits(16), Expect:618, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 4 TACTTATTGTTAATAA 19 |||||||||||||||| Sbjct 12323962 TACTTATTGTTAATAA 12323977

>Proteus mirabilis strain CC15031 chromosome, complete genome Sequence ID: CP048787.1 Length: 4031742 Range 1: 2072141 to 2072158

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2072158 TTATTGTTAATAACGCTA 2072141

>Aphantopus hyperantus genome assembly, chromosome: 16 Sequence ID: LR761663.1 Length: 14440408 Range 1: 625568 to 625589

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 11 TGTTAATAACGCTACTAATGTT 32 ||||||||||||| |||||||| Sbjct 625568 TGTTAATAACGCTTCTAATGTT 625589

Range 2: 10752920 to 10752935

Score:32.2 bits(16), Expect:618, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 2 CCTACTTATTGTTAAT 17 |||||||||||||||| Sbjct 10752935 CCTACTTATTGTTAAT 10752920

>Aphantopus hyperantus genome assembly, chromosome: 1 Sequence ID: LR761647.1 Length: 18856181 Range 1: 8843301 to 8843318

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 8843301 TTATTGTTAATAACGCTA 8843318

>Proteus mirabilis strain N18-00201 chromosome, complete genome Sequence ID: CP048404.1 Length: 3819372 Range 1: 1958465 to 1958482

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1958482 TTATTGTTAATAACGCTA 1958465

>Solanum tuberosum cultivar MSH/14-112 chromosome 1 Sequence ID: CP046702.1 Length: 88648484 Range 1: 17792316 to 17792333

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 CTACTTATTGTTAATAAC 20 |||||||||||||||||| Sbjct 17792333 CTACTTATTGTTAATAAC 17792316

Range 2: 77570854 to 77570873

Score:32.2 bits(16), Expect:618, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Plus

Query 9 ATTGTTAATAACGCTACTAA 28 |||||||||||| ||||||| Sbjct 77570854 ATTGTTAATAACACTACTAA 77570873

>Proteus mirabilis strain SCBX1.1 chromosome, complete genome Sequence ID: CP047112.1 Length: 4200651 Range 1: 2095781 to 2095798

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2095798 TTATTGTTAATAACGCTA 2095781

>Proteus mirabilis strain CRE14IB chromosome, complete genome Sequence ID: CP045538.2 Length: 4018329 Range 1: 2071406 to 2071423

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2071423 TTATTGTTAATAACGCTA 2071406

>PREDICTED: Oreochromis aureus uncharacterized LOC116328903 (LOC116328903), ncRNA Sequence ID: XR_004200122.1 Length: 4337 Range 1: 2168 to 2189

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 11 TGTTAATAACGCTACTAATGTT 32 ||||||||||| |||||||||| Sbjct 2168 TGTTAATAACGTTACTAATGTT 2189

>PREDICTED: Oreochromis aureus uncharacterized LOC116316373 (LOC116316373), ncRNA Sequence ID: XR_004199156.1 Length: 3080 Range 1: 911 to 932

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 11 TGTTAATAACGCTACTAATGTT 32 ||||||||||| |||||||||| Sbjct 911 TGTTAATAACGTTACTAATGTT 932

>Pecten maximus genome assembly, chromosome: 11 Sequence ID: LR736848.1 Length: 44189035 Range 1: 23636737 to 23636754

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 CCCTACTTATTGTTAATA 18 |||||||||||||||||| Sbjct 23636737 CCCTACTTATTGTTAATA 23636754

>Proteus mirabilis strain ENT1224 chromosome Sequence ID: CP044134.1 Length: 4105071 Range 1: 2108385 to 2108402

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2108402 TTATTGTTAATAACGCTA 2108385

>Proteus mirabilis strain ENT1157 chromosome, complete genome Sequence ID: CP044136.1 Length: 4105149 Range 1: 2108475 to 2108492

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2108492 TTATTGTTAATAACGCTA 2108475

>Proteus mirabilis strain ENT1301 chromosome Sequence ID: CP044135.1 Length: 4107982 Range 1: 2110184 to 2110201

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2110201 TTATTGTTAATAACGCTA 2110184

>Caligus rogercresseyi isolate FCH chromosome 16 Sequence ID: CP045905.1 Length: 17561962 Range 1: 12479068 to 12479085

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 12479085 TTATTGTTAATAACGCTA 12479068

>Proteus mirabilis strain K817 chromosome, complete genome Sequence ID: CP044028.1 Length: 4017079 Range 1: 1645923 to 1645940

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1645940 TTATTGTTAATAACGCTA 1645923

>Proteus mirabilis strain S1959 chromosome, complete genome Sequence ID: CP043870.1 Length: 3957207 Range 1: 1299205 to 1299222

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1299222 TTATTGTTAATAACGCTA 1299205

>Proteus mirabilis strain CRPM10 chromosome, complete genome Sequence ID: CP043332.1 Length: 4158695 Range 1: 2168455 to 2168472

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2168472 TTATTGTTAATAACGCTA 2168455

>Helicobacter pylori TN2wt DNA, complete genome Sequence ID: AP019730.1 Length: 1604952 Range 1: 464521 to 464542

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 11 TGTTAATAACGCTACTAATGTT 32 |||||||||||||| ||||||| Sbjct 464521 TGTTAATAACGCTAATAATGTT 464542

Range 2: 786855 to 786870

Score:32.2 bits(16), Expect:618, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 14 TAATAACGCTACTAAT 29 |||||||||||||||| Sbjct 786870 TAATAACGCTACTAAT 786855

>Proteus mirabilis strain VAC chromosome, complete genome Sequence ID: CP042907.1 Length: 4090308 Range 1: 2181323 to 2181340

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2181340 TTATTGTTAATAACGCTA 2181323

>Mucilaginibacter ginsenosidivorans strain Gsoil 3017 chromosome, complete genome Sequence ID: CP042436.1 Length: 5352833 Range 1: 738959 to 738976

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAAC 20 |||||||||||||||||| Sbjct 738959 CTACTTATTGTTAATAAC 738976

>Proteus mirabilis strain CLPM181223 chromosome Sequence ID: CP041391.1 Length: 4049470 Range 1: 835857 to 835874

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 835857 TTATTGTTAATAACGCTA 835874

>Myripristis murdjan genome assembly, chromosome: 6 Sequence ID: LR597555.1 Length: 35357120 Range 1: 20475527 to 20475544

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 20475527 TACTTATTGTTAATAACG 20475544

>PREDICTED: Osmia bicornis bicornis cysteine-rich protein 1-like (LOC114877548), mRNA Sequence ID: XM_029190245.1 Length: 401 Range 1: 363 to 380

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CCTACTTATTGTTAATAA 19 |||||||||||||||||| Sbjct 363 CCTACTTATTGTTAATAA 380

>Pan troglodytes chromosome 2 clone CH251-60P06, complete sequence Sequence ID: AC279084.1 Length: 220887 Range 1: 156933 to 156954

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 9 ATTGTTAATAACGCTACTAATG 30 |||||||| ||||||||||||| Sbjct 156954 ATTGTTAAAAACGCTACTAATG 156933

>Pan troglodytes chromosome 2 clone CH251-17O22, complete sequence Sequence ID: AC278930.1 Length: 184383 Range 1: 65635 to 65656

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 9 ATTGTTAATAACGCTACTAATG 30 |||||||| ||||||||||||| Sbjct 65635 ATTGTTAAAAACGCTACTAATG 65656

>Pan troglodytes chromosome 2 clone CH251-108A24, complete sequence Sequence ID: AC278921.1 Length: 151648 Range 1: 3496 to 3517

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 9 ATTGTTAATAACGCTACTAATG 30 |||||||| ||||||||||||| Sbjct 3496 ATTGTTAAAAACGCTACTAATG 3517

>Proteus mirabilis strain PmSC1111 chromosome, complete genome Sequence ID: CP034090.1 Length: 4189199 Range 1: 1222567 to 1222584

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1222567 TTATTGTTAATAACGCTA 1222584

>Proteus mirabilis strain PmBC1123 chromosome, complete genome Sequence ID: CP034091.1 Length: 4074828 Range 1: 1937947 to 1937964

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1937964 TTATTGTTAATAACGCTA 1937947

>Helicobacter pylori strain Hpbs1 chromosome, complete genome Sequence ID: CP034071.1 Length: 1563701 Range 1: 1064617 to 1064638

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 11 TGTTAATAACGCTACTAATGTT 32 |||||||||||||| ||||||| Sbjct 1064638 TGTTAATAACGCTAATAATGTT 1064617

>PREDICTED: Ooceraea biroi uncharacterized LOC105286741 (LOC105286741), ncRNA Sequence ID: XR_895306.2 Length: 976 Range 1: 702 to 719

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 6 CTTATTGTTAATAACGCT 23 |||||||||||||||||| Sbjct 702 CTTATTGTTAATAACGCT 719

>PREDICTED: Rhopalosiphum maidis probable serine/threonine-protein kinase MARK-A (LOC113553646), transcript variant X2, mRNA Sequence ID: XM_026957090.1 Length: 4089 Range 1: 2148 to 2165

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 12 GTTAATAACGCTACTAAT 29 |||||||||||||||||| Sbjct 2165 GTTAATAACGCTACTAAT 2148

>PREDICTED: Rhopalosiphum maidis probable serine/threonine-protein kinase MARK-A (LOC113553646), transcript variant X1, mRNA Sequence ID: XM_026957089.1 Length: 4278 Range 1: 2337 to 2354

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 12 GTTAATAACGCTACTAAT 29 |||||||||||||||||| Sbjct 2354 GTTAATAACGCTACTAAT 2337

>PREDICTED: Trichoplusia ni protein shuttle craft (LOC113492111), mRNA Sequence ID: XM_026869428.1 Length: 6322 Range 1: 5651 to 5668

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 5668 TACTTATTGTTAATAACG 5651

>Bacillus litoralis strain Bac94 chromosome, complete genome Sequence ID: CP033043.1 Length: 5230624 Range 1: 4773514 to 4773531

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 4773531 TACTTATTGTTAATAACG 4773514

>Eukaryotic synthetic construct chromosome 21 Sequence ID: CP034500.1 Length: 38708702 >Eukaryotic synthetic construct chromosome 21 Sequence ID: CP034525.1 Length: 38708702 Range 1: 162187 to 162208

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 9 ATTGTTAATAACGCTACTAATG 30 |||||||| ||||||||||||| Sbjct 162187 ATTGTTAAAAACGCTACTAATG 162208

>Proteus mirabilis strain NCTC4199 genome assembly, chromosome: 1 Sequence ID: LR134205.1 Length: 3875274 Range 1: 1975860 to 1975877

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1975877 TTATTGTTAATAACGCTA 1975860

>PREDICTED: Solanum lycopersicum beta-amyrin 28-monooxygenase-like (LOC101260468), mRNA Sequence ID: XM_004228912.4 Length: 2719 Range 1: 942 to 959

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAAC 20 |||||||||||||||||| Sbjct 942 CTACTTATTGTTAATAAC 959

>Proteus mirabilis strain AR_0029 chromosome, complete genome Sequence ID: CP029725.1 Length: 3980098 Range 1: 941592 to 941609

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 941592 TTATTGTTAATAACGCTA 941609

>PREDICTED: Pomacea canaliculata toll-like receptor 13 (LOC112572738), mRNA Sequence ID: XM_025252572.1 Length: 4220 Range 1: 866 to 883

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 866 TTATTGTTAATAACGCTA 883

>Proteus mirabilis strain CCUG 70746 chromosome Sequence ID: CP023273.1 Length: 3909869 Range 1: 626207 to 626224

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 626207 TTATTGTTAATAACGCTA 626224

>PREDICTED: Tetranychus urticae dopamine receptor 2-like (LOC107365195), mRNA Sequence ID: XM_025161470.1 Length: 3720 Range 1: 2783 to 2808

Score:36.2 bits(18), Expect:40, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTACTAATGTT 32 ||||||||| | |||||||||||||| Sbjct 2808 TTATTGTTATTGACGCTACTAATGTT 2783

>Bacillus cytotoxicus strain CH_1 chromosome, complete genome Sequence ID: CP024120.1 Length: 4147576 Range 1: 524623 to 524640

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 524640 TACTTATTGTTAATAACG 524623

>Bacillus cytotoxicus strain CH_2 chromosome, complete genome Sequence ID: CP024116.1 Length: 4252735 Range 1: 562945 to 562962

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 562962 TACTTATTGTTAATAACG 562945

>Bacillus cytotoxicus strain CH_3 chromosome, complete genome Sequence ID: CP024113.1 Length: 4245145 Range 1: 562944 to 562961

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 562961 TACTTATTGTTAATAACG 562944

>Bacillus cytotoxicus strain CH_4 chromosome, complete genome Sequence ID: CP024111.1 Length: 4220037 Range 1: 2369299 to 2369316

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 2369299 TACTTATTGTTAATAACG 2369316

>Bacillus cytotoxicus strain CH_13 chromosome, complete genome Sequence ID: CP024109.1 Length: 4082665 Range 1: 522738 to 522755

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 522755 TACTTATTGTTAATAACG 522738

>Bacillus cytotoxicus strain CH_15 chromosome, complete genome Sequence ID: CP024107.1 Length: 4220037 Range 1: 2369299 to 2369316

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 2369299 TACTTATTGTTAATAACG 2369316

>Bacillus cytotoxicus strain CH_23 chromosome, complete genome Sequence ID: CP024104.1 Length: 4196763 Range 1: 524597 to 524614

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 524614 TACTTATTGTTAATAACG 524597

>Bacillus cytotoxicus strain CH_25 chromosome, complete genome Sequence ID: CP024101.1 Length: 4225378 Range 1: 524618 to 524635

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 524635 TACTTATTGTTAATAACG 524618

>Bacillus cytotoxicus strain CH_38 chromosome, complete genome Sequence ID: CP024098.1 Length: 4215994 Range 1: 562917 to 562934

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 562934 TACTTATTGTTAATAACG 562917

>Bacillus cytotoxicus strain CH_39 chromosome, complete genome Sequence ID: CP024096.1 Length: 4252957 Range 1: 562932 to 562949

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 4 TACTTATTGTTAATAACG 21 |||||||||||||||||| Sbjct 562949 TACTTATTGTTAATAACG 562932

>Proteus mirabilis strain AR379 chromosome, complete genome Sequence ID: CP029133.1 Length: 4219380 Range 1: 1380057 to 1380074

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1380057 TTATTGTTAATAACGCTA 1380074

>Proteus mirabilis strain K1609 chromosome Sequence ID: CP028522.1 Length: 3817795 Range 1: 2888282 to 2888299

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2888299 TTATTGTTAATAACGCTA 2888282

>Proteus mirabilis strain K670 chromosome Sequence ID: CP028356.1 Length: 3935626 Range 1: 2075630 to 2075647

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2075647 TTATTGTTAATAACGCTA 2075630

>Proteus mirabilis strain FDAARGOS_67 chromosome, complete genome Sequence ID: CP026051.1 Length: 3955473 Range 1: 491464 to 491481

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 491481 TTATTGTTAATAACGCTA 491464

>Proteus mirabilis isolate GN2 chromosome, complete genome Sequence ID: CP026581.1 Length: 4012640 Range 1: 2124774 to 2124791

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2124791 TTATTGTTAATAACGCTA 2124774

>Proteus mirabilis strain BC11-24 chromosome, complete genome Sequence ID: CP026571.1 Length: 4021165 Range 1: 1973904 to 1973921

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1973921 TTATTGTTAATAACGCTA 1973904

>PREDICTED: Lactuca sativa gamma-glutamyl hydrolase 2-like (LOC111913893), mRNA Sequence ID: XM_023909608.1 Length: 1537 Range 1: 493 to 510

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 13 TTAATAACGCTACTAATG 30 |||||||||||||||||| Sbjct 493 TTAATAACGCTACTAATG 510

>Proteus mirabilis strain FDAARGOS_81 chromosome, complete genome Sequence ID: CP026062.1 Length: 4077315 Range 1: 1908296 to 1908313

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1908296 TTATTGTTAATAACGCTA 1908313

>Proteus mirabilis strain FDAARGOS_60 chromosome, complete genome Sequence ID: CP026044.1 Length: 4105573 Range 1: 1657130 to 1657147

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 1657130 TTATTGTTAATAACGCTA 1657147

>Solanum lycopersicum cultivar I-3 chromosome 1 Sequence ID: CP023757.1 Length: 98550989 Range 1: 42508108 to 42508125

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 CTACTTATTGTTAATAAC 20 |||||||||||||||||| Sbjct 42508108 CTACTTATTGTTAATAAC 42508125

>PREDICTED: Durio zibethinus universal stress protein PHOS32-like (LOC111287129), mRNA Sequence ID: XM_022877387.1 Length: 2592 Range 1: 1273 to 1294

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 10 TTGTTAATAACGCTACTAATGT 31 |||| ||||||||||||||||| Sbjct 1273 TTGTAAATAACGCTACTAATGT 1294

>Yersinia frederiksenii strain FDAARGOS_417 chromosome, complete genome Sequence ID: CP023962.1 Length: 5000678 Range 1: 1194793 to 1194810

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 9 ATTGTTAATAACGCTACT 26 |||||||||||||||||| Sbjct 1194793 ATTGTTAATAACGCTACT 1194810

>Proteus mirabilis strain T18 chromosome, complete genome Sequence ID: CP017085.1 Length: 4131426 Range 1: 2430551 to 2430568

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 2430568 TTATTGTTAATAACGCTA 2430551

>Proteus mirabilis strain T21, complete genome Sequence ID: CP017082.1 Length: 4090879 Range 1: 3211349 to 3211366

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 3211349 TTATTGTTAATAACGCTA 3211366

>Proteus mirabilis strain AR_0156, complete genome Sequence ID: CP021852.1 Length: 4209445 Range 1: 46893 to 46910

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 46910 TTATTGTTAATAACGCTA 46893

>Proteus mirabilis strain AR_0159, complete genome Sequence ID: CP021550.1 Length: 4055152 Range 1: 304482 to 304499

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 304482 TTATTGTTAATAACGCTA 304499

>Agarilytica rhodophyticola strain 017 chromosome, complete genome Sequence ID: CP020038.1 Length: 6878829 Range 1: 3868033 to 3868054

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 7 TTATTGTTAATAACGCTACTAA 28 ||||||| |||||||||||||| Sbjct 3868054 TTATTGTCAATAACGCTACTAA 3868033

>Proteus mirabilis strain AR_0059, complete genome Sequence ID: CP020052.1 Length: 4191021 Range 1: 3252122 to 3252139

Score:36.2 bits(18), Expect:40, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 TTATTGTTAATAACGCTA 24 |||||||||||||||||| Sbjct 3252122 TTATTGTTAATAACGCTA 3252139

>Homo sapiens BAC clone CH17-289H4 from chromosome 9, complete sequence Sequence ID: AC275593.1 Length: 199626 Range 1: 133392 to 133413

Score:36.2 bits(18), Expect:40, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 9 ATTGTTAATAACGCTACTAATG 30 |||||||| ||||||||||||| Sbjct 133392 ATTGTTAAAAACGCTACTAATG 133413

>Solanum tuberosum cultivar P8 chromosome 1 Sequence ID: CP046688.1 Length: 88647716 Range 1: 14008857 to 14008876

Score:32.2 bits(16), Expect:618, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Minus

Query 9 ATTGTTAATAACGCTACTAA 28 |||||||||||| ||||||| Sbjct 14008876 ATTGTTAATAACACTACTAA 14008857

Range 2: 17792231 to 17792248

Score:32.2 bits(16), Expect:618, Identities:17/18(94%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 CTACTTATTGTTAATAAC 20 |||||||||| ||||||| Sbjct 17792248 CTACTTATTGYTAATAAC 17792231

Range 3: 77570502 to 77570521

Score:32.2 bits(16), Expect:618, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Plus

Query 9 ATTGTTAATAACGCTACTAA 28 |||||||||||| ||||||| Sbjct 77570502 ATTGTTAATAACACTACTAA 77570521