Afvpeerv016 alignment txt

créé le: 20200428
mis à jour le: 20200428
généré le:20200525_110104

Region HIV2a 24-43: HIV-2 isolate 106CP_RT from Cote d'Ivoire reverse transcriptase gene, partial cds Sequence ID: KJ131112.1Length: 924Number of Matches: 1 ACTTGTTCTTACCTTTCTTT

RID: AFVPEERV016 Job Title:Nucleotide Sequence Program: BLASTN Database: nt Nucleotide collection (nt) Query #1: Query ID: lcl|Query_64465 Length: 20

Sequences producing significant alignments:

 Max  TotalQueryE  Per.    
Description  ScoreScorecoverValueIdent Accession  
Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 40.1  40.1  100%  0.46  100.00  MT108784.1  
Salarias fasciatus genome assembly, chromosome: 12  40.1  40.1  100%  0.46  100.00  LR597447.1  
Morus alba cultivar Heyebai chromosome 1  36.2  541  100%  7.2  100.00  CP050224.1  
Lotus japonicus B-129 DNA, chromosome 6, complete sequence  36.2  159  100%  7.2  100.00  AP022634.1  
Chanos chanos genome assembly, chromosome: 4  36.2  126  100%  7.2  100.00  LR697109.1  
Myripristis murdjan genome assembly, chromosome: 22  36.2  98.6  100%  7.2  100.00  LR597571.1  
Streptopelia turtur genome assembly, chromosome: 7  36.2  161  100%  7.2  100.00  LR594557.1  
Streptopelia turtur genome assembly, chromosome: Z  36.2  278  100%  7.2  100.00  LR594555.1  
Gouania willdenowi genome assembly, chromosome: 21  36.2  128  100%  7.2  100.00  LR132001.1  
Eukaryotic synthetic construct chromosome 15  36.2  98.6  100%  7.2  100.00  CP034493.1  
Vibrio coralliilyticus OCN008 chromosome II, complete sequence  36.2  36.2  90%  7.2  100.00  CP048694.1  
Crassostrea gigas strain QD chromosome 3  36.2  102  90%  7.2  100.00  CP048841.1  
Crassostrea gigas genome assembly, linkage group: LG5  36.2  70.4  90%  7.2  100.00  LR761638.1  
Solanum pinnatisectum cultivar CGN17745 chromosome 3  36.2  36.2  90%  7.2  100.00  CP047566.1  
Solanum tuberosum cultivar P8 chromosome 12  36.2  36.2  90%  7.2  100.00  CP046681.1  
Solanum tuberosum cultivar MSH/14-112 chromosome 12  36.2  36.2  90%  7.2  100.00  CP046697.1  
Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence  36.2  36.2  90%  7.2  100.00  CP046163.1  
Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence  36.2  36.2  90%  7.2  100.00  CP046066.1  
Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence  36.2  36.2  90%  7.2  100.00  CP045356.1  
Parastagonospora nodorum strain Sn79 chromosome 20  36.2  36.2  90%  7.2  100.00  CP039689.1  
Rattus norvegicus autism susceptibility candidate 2-like 1...  36.2  36.2  90%  7.2  100.00  NM_001107136.2
Haemonchus contortus strain NZ_Hco_NP chromosome 3  36.2  66.4  90%  7.2  100.00  CP035802.1  
Sphaeramia orbicularis genome assembly, chromosome: 7  36.2  36.2  90%  7.2  100.00  LR597464.1  
Shewanella marisflavi strain ECSMB14101 chromosome, complete...  36.2  36.2  90%  7.2  100.00  CP041153.1  
PREDICTED: Elaeis guineensis protein SMAX1-like (LOC105039233)... 36.2  36.2  90%  7.2  100.00  XM_010915312.3
Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Cambria0299,...  36.2  36.2  90%  7.2  100.00  MK764040.1  
Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Cambria0298...  36.2  36.2  90%  7.2  100.00  MK764039.1  
Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Douglas0940...  36.2  36.2  90%  7.2  100.00  MK753012.1  
Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Washington0526...  36.2  36.2  90%  7.2  100.00  MK753007.1  
Takifugu rubripes genome assembly, chromosome: 7  36.2  36.2  90%  7.2  100.00  LR584238.1  
Scleropages formosus genome assembly, chromosome: 5  36.2  36.2  90%  7.2  100.00  LR584070.1  
Homo sapiens chromosome 15 clone VMRC59-280I06, complete sequence36.2  36.2  90%  7.2  100.00  AC279072.1  
Homo sapiens chromosome 10 clone VMRC53-75M10, complete sequence  36.2  36.2  90%  7.2  100.00  AC278846.1  
Homo sapiens chromosome 10 clone VMRC62-410O10, complete sequence36.2  36.2  90%  7.2  100.00  AC278634.1  
Homo sapiens chromosome 10 clone VMRC62-122A13, complete sequence36.2  36.2  90%  7.2  100.00  AC278587.1  
Homo sapiens chromosome 10 clone VMRC62-224B15, complete sequence36.2  36.2  90%  7.2  100.00  AC278459.1  
Homo sapiens chromosome 10 clone VMRC64-249A18, complete sequence36.2  36.2  90%  7.2  100.00  AC278253.1  
Betta splendens genome assembly, chromosome: 16  36.2  36.2  90%  7.2  100.00  LR132009.2  
Eukaryotic synthetic construct chromosome 19  36.2  36.2  90%  7.2  100.00  CP034522.1  
Eukaryotic synthetic construct chromosome 19  36.2  36.2  90%  7.2  100.00  CP034497.1  
Vibrio coralliilyticus strain RE22 chromosome 2, complete...  36.2  36.2  90%  7.2  100.00  CP031473.1  
homo sapiens BAC clone CH17-284L16 from chromosome 10, complet... 36.2  36.2  90%  7.2  100.00  AC278009.1  
Norovirus GII isolate NORO_170_23_09_2014, complete genome  36.2  36.2  90%  7.2  100.00  MH218639.1  
PREDICTED: Gallus gallus FRA10A associated CGG repeat 1...  36.2  36.2  90%  7.2  100.00  XR_001467220.2
Strongyloides ratti Epidermal growth factor-like...  36.2  36.2  90%  7.2  100.00  XM_024647979.1
Fusarium venenatum strain A3/5 genome assembly, chromosome: I  36.2  36.2  90%  7.2  100.00  LN649229.1  
PREDICTED: Lactuca sativa uncharacterized LOC111918660...  36.2  36.2  90%  7.2  100.00  XM_023914325.1
PREDICTED: Spodoptera litura calponin homology domain-containi... 36.2  36.2  90%  7.2  100.00  XM_022981828.1
PREDICTED: Spodoptera litura calponin homology domain-containi... 36.2  36.2  90%  7.2  100.00  XM_022981827.1
PREDICTED: Spodoptera litura calponin homology domain-containi... 36.2  36.2  90%  7.2  100.00  XM_022981826.1
PREDICTED: Spodoptera litura calponin homology domain-containi... 36.2  36.2  90%  7.2  100.00  XM_022981825.1
Solanum lycopersicum cultivar I-3 chromosome 3  36.2  126  90%  7.2  100.00  CP023759.1  
Norovirus GII strain...  36.2  36.2  90%  7.2  100.00  MF140648.1  
Norovirus GII strain...  36.2  36.2  90%  7.2  100.00  MF140647.1  
Norovirus GII strain...  36.2  36.2  90%  7.2  100.00  MF140646.1  
Norovirus GII strain...  36.2  36.2  90%  7.2  100.00  MF140645.1  
Gossypium hirsutum cultivar TM1 chromosome A11  36.2  66.4  90%  7.2  100.00  CP023743.1  
Sapovirus GXI/HgTa2-2-2 genomic RNA, nearly complete genome  36.2  36.2  90%  7.2  100.00  LC215898.1  
Sapovirus GVII/Ishi-Im3-1 genomic RNA, nearly complete genome  36.2  36.2  90%  7.2  100.00  LC215894.1  
Sapovirus GVII/Ishi-Im1-2 genomic RNA, nearly complete genome  36.2  36.2  90%  7.2  100.00  LC215892.1  
Sapovirus GVII/MoI2-1-2 genomic RNA, nearly complete genome  36.2  36.2  90%  7.2  100.00  LC215891.1  
Sapovirus GVI/Ishi-Im7-2 genomic RNA, nearly complete genome  36.2  36.2  90%  7.2  100.00  LC215887.1  
Parastagonospora nodorum isolate Sn79-1087 chromosome 20,...  36.2  36.2  90%  7.2  100.00  CP022872.1  
Parastagonospora nodorum isolate Sn2000 chromosome 20 sequence  36.2  36.2  90%  7.2  100.00  CP022847.1  
Parastagonospora nodorum isolate LDN03-Sn4 chromosome 20,...  36.2  36.2  90%  7.2  100.00  CP022820.1  
Oryzias latipes strain HNI chromosome 15  36.2  36.2  90%  7.2  100.00  CP020793.1  
Oryzias latipes strain Hd-rR chromosome 10 sequence  36.2  98.6  90%  7.2  100.00  CP020674.1  
PREDICTED: Hevea brasiliensis transcriptional regulator...  36.2  36.2  90%  7.2  100.00  XM_021789274.1
PREDICTED: Hevea brasiliensis dentin sialophosphoprotein-like...  36.2  36.2  90%  7.2  100.00  XM_021789257.1
Vibrio coralliilyticus strain SNUTY-1 chromosome II, complete...  36.2  36.2  90%  7.2  100.00  CP020454.1  
Morus alba cultivar Heyebai chromosome 3  38.2  128  95%  1.8  100.00  CP050226.1  
Norovirus GII isolate 3549, complete genome  38.2  38.2  95%  1.8  100.00  MK789435.1  
Brassica oleracea HDEM genome, scaffold: C2  38.2  159  95%  1.8  100.00  LR031874.1  
Norovirus GII isolate NORO_42_01_09_2014, complete genome  38.2  38.2  95%  1.8  100.00  MH218701.1  
Norovirus GII isolate NORO_155_02_03_2015, complete genome  38.2  38.2  95%  1.8  100.00  MH218626.1  
PREDICTED: Equus caballus uncharacterized LOC111774923...  38.2  38.2  95%  1.8  100.00  XR_002810250.1
PREDICTED: Equus caballus phospholipid-transporting ATPase Fet... 38.2  38.2  95%  1.8  100.00  XM_014735885.2
Kazachstania africana CBS 2517 hypothetical protein...  38.2  38.2  95%  1.8  100.00  XM_003958896.1
Kazachstania africana CBS 2517 chromosome 9, complete genome  38.2  38.2  95%  1.8  100.00  HE650829.1  
Equus caballus microsatellite DNA, locus ABGe4925  38.2  38.2  95%  1.8  100.00  FN408575.1  
Crimean-Congo hemorrhagic fever virus strain ArD39554 segment ... 38.2  38.2  95%  1.8  100.00  DQ211628.1  
Morus alba cultivar Heyebai chromosome 2  36.2  259  95%  7.2  100.00  CP050225.1  
Canis lupus familiaris breed Labrador retriever chromosome 28a  36.2  96.6  95%  7.2  100.00  CP050584.1  
Canis lupus familiaris breed Labrador retriever chromosome 28b  36.2  96.6  95%  7.2  100.00  CP050626.1  
Coregonus sp. 'balchen' genome assembly, chromosome: 8  36.2  66.4  95%  7.2  100.00  LR778260.1  
Epinephelus fuscoguttatus DNA, LG2, complete sequence  36.2  128  95%  7.2  100.00  AP022676.1  
Solanum pinnatisectum cultivar CGN17745 chromosome 2  36.2  98.6  95%  7.2  100.00  CP047559.1  
Solanum tuberosum cultivar P8 chromosome 2  36.2  66.4  95%  7.2  100.00  CP046680.1  
Solanum tuberosum cultivar MSH/14-112 chromosome 2  36.2  66.4  95%  7.2  100.00  CP046695.1  
Sciurus carolinensis genome assembly, chromosome: 18  36.2  96.6  95%  7.2  100.00  LR738608.1  
Gossypium turneri isolate D10-2 chromosome D10_03  36.2  467  95%  7.2  100.00  CP032573.1  
Sparus aurata genome assembly, chromosome: 13  36.2  66.4  95%  7.2  100.00  LR537133.1  
Aquila chrysaetos chrysaetos genome assembly, chromosome: 6  36.2  157  95%  7.2  100.00  LR606186.1  
Gossypium raimondii isolate D5-4 chromosome D5_03  36.2  161  95%  7.2  100.00  CP032555.1  
Syngnathus acus genome assembly, chromosome: 9  36.2  96.6  95%  7.2  100.00  LR594594.1  
Salmo trutta genome assembly, chromosome: 12  36.2  598  95%  7.2  100.00  LR584441.1  
Brassica oleracea HDEM genome, scaffold: C1  36.2  128  95%  7.2  100.00  LR031878.1  
Haemonchus contortus, ISE/inbred ISE, WGS project CAVP01000000... 36.2  96.6  95%  7.2  100.00  LS997564.1  
Lupinus angustifolius cultivar Tanjil chromosome LG-14  36.2  66.4  95%  7.2  100.00  CP023126.1  
Lupinus angustifolius cultivar Tanjil chromosome LG-09  36.2  98.6  95%  7.2  100.00  CP023121.1  
nbr              
             
100.000000            

Alignments: >Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and N genes, complete cds Sequence ID: MT108784.1 Length: 29891 Range 1: 21720 to 21739

Score:40.1 bits(20), Expect:0.46, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCTTT 20 |||||||||||||||||||| Sbjct 21720 ACTTGTTCTTACCTTTCTTT 21739

>Salarias fasciatus genome assembly, chromosome: 12 Sequence ID: LR597447.1 Length: 32729575 Range 1: 17782052 to 17782071

Score:40.1 bits(20), Expect:0.46, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTTT 20 |||||||||||||||||||| Sbjct 17782071 ACTTGTTCTTACCTTTCTTT 17782052

>Morus alba cultivar Heyebai chromosome 3 Sequence ID: CP050226.1 Length: 25387778 Range 1: 12131138 to 12131156

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||||||||||||| Sbjct 12131156 CTTGTTCTTACCTTTCTTT 12131138

Range 2: 9150505 to 9150523

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 9150505 CTTGTTCTTTCCTTTCTTT 9150523

Range 3: 12765119 to 12765137

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 12765137 CTTGTTCTTTCCTTTCTTT 12765119

Range 4: 22961117 to 22961131

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 22961131 TTCTTACCTTTCTTT 22961117

>Norovirus GII isolate 3549, complete genome Sequence ID: MK789435.1 Length: 7569 Range 1: 2633 to 2651

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTT 19 ||||||||||||||||||| Sbjct 2651 ACTTGTTCTTACCTTTCTT 2633

>Brassica oleracea HDEM genome, scaffold: C2 Sequence ID: LR031874.1 Length: 63782621 Range 1: 27818403 to 27818421

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||||||||||||| Sbjct 27818421 CTTGTTCTTACCTTTCTTT 27818403

Range 2: 16226858 to 16226872

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 16226858 TTCTTACCTTTCTTT 16226872

Range 3: 39824324 to 39824342

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 39824342 CTTGTTCTTCCCTTTCTTT 39824324

Range 4: 49601966 to 49601980

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 49601980 TTCTTACCTTTCTTT 49601966

Range 5: 51482738 to 51482756

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||| ||||||||||||| Sbjct 51482756 CTTGTCCTTACCTTTCTTT 51482738

>Norovirus GII isolate NORO_42_01_09_2014, complete genome Sequence ID: MH218701.1 Length: 7546 Range 1: 2633 to 2651

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTT 19 ||||||||||||||||||| Sbjct 2651 ACTTGTTCTTACCTTTCTT 2633

>Norovirus GII isolate NORO_155_02_03_2015, complete genome Sequence ID: MH218626.1 Length: 7560 Range 1: 2633 to 2651

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTT 19 ||||||||||||||||||| Sbjct 2651 ACTTGTTCTTACCTTTCTT 2633

>PREDICTED: Equus caballus uncharacterized LOC111774923 (LOC111774923), ncRNA Sequence ID: XR_002810250.1 Length: 21183 Range 1: 6351 to 6369

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||||||||||||| Sbjct 6369 CTTGTTCTTACCTTTCTTT 6351

>PREDICTED: Equus caballus phospholipid-transporting ATPase FetA (LOC100068071), transcript variant X12, mRNA Sequence ID: XM_014735885.2 Length: 5845 Range 1: 535 to 553

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||||||||||||| Sbjct 535 CTTGTTCTTACCTTTCTTT 553

>Kazachstania africana CBS 2517 hypothetical protein (KAFR0I00290), partial mRNA Sequence ID: XM_003958896.1 Length: 3348 Range 1: 1794 to 1812

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||||||||||||| Sbjct 1812 CTTGTTCTTACCTTTCTTT 1794

>Kazachstania africana CBS 2517 chromosome 9, complete genome Sequence ID: HE650829.1 Length: 607727 Range 1: 61844 to 61862

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||||||||||||| Sbjct 61844 CTTGTTCTTACCTTTCTTT 61862

>Equus caballus microsatellite DNA, locus ABGe4925 Sequence ID: FN408575.1 Length: 263 Range 1: 230 to 248

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||||||||||||| Sbjct 248 CTTGTTCTTACCTTTCTTT 230

>Crimean-Congo hemorrhagic fever virus strain ArD39554 segment M, complete sequence Sequence ID: DQ211628.1 Length: 5431 Range 1: 5076 to 5094

Score:38.2 bits(19), Expect:1.8, Identities:19/19(100%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTT 19 ||||||||||||||||||| Sbjct 5094 ACTTGTTCTTACCTTTCTT 5076

>Morus alba cultivar Heyebai chromosome 2 Sequence ID: CP050225.1 Length: 35990041 Range 1: 11069255 to 11069272

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 11069272 TTGTTCTTACCTTTCTTT 11069255

Range 2: 34078006 to 34078023

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 34078023 CTTGTTCTTACCTTTCTT 34078006

Range 3: 34078973 to 34078990

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 34078990 CTTGTTCTTACCTTTCTT 34078973

Range 4: 17502735 to 17502749

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 17502749 CTTGTTCTTACCTTT 17502735

Range 5: 17503965 to 17503979

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 17503979 CTTGTTCTTACCTTT 17503965

Range 6: 17504935 to 17504949

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 17504949 CTTGTTCTTACCTTT 17504935

Range 7: 19431935 to 19431953

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 19431953 CTTGTTCTTTCCTTTCTTT 19431935

Range 8: 21083423 to 21083441

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 21083441 CTTGTTCTTTCCTTTCTTT 21083423

>Morus alba cultivar Heyebai chromosome 1 Sequence ID: CP050224.1 Length: 70891152 Range 1: 40578221 to 40578238

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 40578238 TTGTTCTTACCTTTCTTT 40578221

Range 2: 40579201 to 40579218

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 40579218 TTGTTCTTACCTTTCTTT 40579201

Range 3: 40580194 to 40580211

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 40580211 TTGTTCTTACCTTTCTTT 40580194

Range 4: 40581187 to 40581204

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 40581204 TTGTTCTTACCTTTCTTT 40581187

Range 5: 22613101 to 22613116

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 22613116 TGTTCTTACCTTTCTT 22613101

Range 6: 58009497 to 58009512

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 GTTCTTACCTTTCTTT 20 |||||||||||||||| Sbjct 58009497 GTTCTTACCTTTCTTT 58009512

Range 7: 10322988 to 10323006

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 10323006 CTTGTTCTTGCCTTTCTTT 10322988

Range 8: 13680998 to 13681012

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTT 15 ||||||||||||||| Sbjct 13680998 ACTTGTTCTTACCTT 13681012

Range 9: 23506954 to 23506968

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 23506968 CTTGTTCTTACCTTT 23506954

Range 10: 24497547 to 24497561

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 24497547 CTTGTTCTTACCTTT 24497561

Range 11: 28780038 to 28780056

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 28780056 CTTGTTCTTTCCTTTCTTT 28780038

Range 12: 28781031 to 28781049

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 28781049 CTTGTTCTTTCCTTTCTTT 28781031

Range 13: 36156268 to 36156286

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 36156286 CTTGTTCTTTCCTTTCTTT 36156268

Range 14: 45441179 to 45441193

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 45441179 CTTGTTCTTACCTTT 45441193

Range 15: 51065674 to 51065688

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 5 GTTCTTACCTTTCTT 19 ||||||||||||||| Sbjct 51065688 GTTCTTACCTTTCTT 51065674

Range 16: 52283884 to 52283898

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 5 GTTCTTACCTTTCTT 19 ||||||||||||||| Sbjct 52283898 GTTCTTACCTTTCTT 52283884

Range 17: 56972247 to 56972265

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 56972265 CTTGTTCTTTCCTTTCTTT 56972247

>Canis lupus familiaris breed Labrador retriever chromosome 28a Sequence ID: CP050584.1 Length: 41217541 Range 1: 1141911 to 1141928

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 1141911 CTTGTTCTTACCTTTCTT 1141928

Range 2: 17939521 to 17939535

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 17939535 TTCTTACCTTTCTTT 17939521

Range 3: 27060353 to 27060367

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 27060353 TTCTTACCTTTCTTT 27060367

>Canis lupus familiaris breed Labrador retriever chromosome 28b Sequence ID: CP050626.1 Length: 41256193 Range 1: 1139297 to 1139314

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 1139297 CTTGTTCTTACCTTTCTT 1139314

Range 2: 17973359 to 17973373

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 17973373 TTCTTACCTTTCTTT 17973359

Range 3: 27096627 to 27096641

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 27096627 TTCTTACCTTTCTTT 27096641

>Lotus japonicus B-129 DNA, chromosome 6, complete sequence Sequence ID: AP022634.1 Length: 67910847 Range 1: 52006818 to 52006835

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 52006835 CTTGTTCTTACCTTTCTT 52006818

Range 2: 63278098 to 63278113

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCT 18 |||||||||||||||| Sbjct 63278098 TTGTTCTTACCTTTCT 63278113

Range 3: 7374004 to 7374018

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 7374004 TTCTTACCTTTCTTT 7374018

Range 4: 49792440 to 49792454

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTT 15 ||||||||||||||| Sbjct 49792454 ACTTGTTCTTACCTT 49792440

Range 5: 66418026 to 66418040

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 66418026 TTCTTACCTTTCTTT 66418040

>Vibrio coralliilyticus OCN008 chromosome II, complete sequence Sequence ID: CP048694.1 Length: 1907002 Range 1: 477450 to 477467

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 477450 ACTTGTTCTTACCTTTCT 477467

>Coregonus sp. 'balchen' genome assembly, chromosome: 8 Sequence ID: LR778260.1 Length: 68138733 Range 1: 50543821 to 50543838

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 50543838 CTTGTTCTTACCTTTCTT 50543821

Range 2: 34437803 to 34437817

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTT 15 ||||||||||||||| Sbjct 34437817 ACTTGTTCTTACCTT 34437803

>Crassostrea gigas strain QD chromosome 3 Sequence ID: CP048841.1 Length: 63080788 Range 1: 379588 to 379605

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 379605 TTGTTCTTACCTTTCTTT 379588

Range 2: 424138 to 424155

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 424155 TTGTTCTTACCTTTCTTT 424138

Range 3: 39241311 to 39241325

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 5 GTTCTTACCTTTCTT 19 ||||||||||||||| Sbjct 39241325 GTTCTTACCTTTCTT 39241311

>Epinephelus fuscoguttatus DNA, LG2, complete sequence Sequence ID: AP022676.1 Length: 52288159 Range 1: 24061615 to 24061632

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 24061615 TTGTTCTTACCTTTCTTT 24061632

Range 2: 33759817 to 33759832

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCT 18 |||||||||||||||| Sbjct 33759832 TTGTTCTTACCTTTCT 33759817

Range 3: 12359573 to 12359591

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 |||||||||||||| |||| Sbjct 12359591 CTTGTTCTTACCTTGCTTT 12359573

Range 4: 36623300 to 36623314

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 36623314 TTCTTACCTTTCTTT 36623300

>Crassostrea gigas genome assembly, linkage group: LG5 Sequence ID: LR761638.1 Length: 73550375 Range 1: 69676438 to 69676455

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 69676438 TTGTTCTTACCTTTCTTT 69676455

Range 2: 29369034 to 29369050

Score:34.2 bits(17), Expect:28, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTTT 20 ||||||||||||||||| Sbjct 29369050 TGTTCTTACCTTTCTTT 29369034

>Solanum pinnatisectum cultivar CGN17745 chromosome 3 Sequence ID: CP047566.1 Length: 62237402 Range 1: 59997419 to 59997436

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 59997436 TTGTTCTTACCTTTCTTT 59997419

>Solanum pinnatisectum cultivar CGN17745 chromosome 2 Sequence ID: CP047559.1 Length: 48601058 Range 1: 14069764 to 14069781

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 14069781 TTGTTCTTACCTTTCTTT 14069764

Range 2: 27878610 to 27878625

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 GTTCTTACCTTTCTTT 20 |||||||||||||||| Sbjct 27878610 GTTCTTACCTTTCTTT 27878625

Range 3: 44694039 to 44694057

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 44694057 CTTGTTCTTTCCTTTCTTT 44694039

>Solanum tuberosum cultivar P8 chromosome 12 Sequence ID: CP046681.1 Length: 61163424 Range 1: 17959346 to 17959363

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 17959346 TTGTTCTTACCTTTCTTT 17959363

>Solanum tuberosum cultivar P8 chromosome 2 Sequence ID: CP046680.1 Length: 48611948 Range 1: 14074031 to 14074048

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 14074048 TTGTTCTTACCTTTCTTT 14074031

Range 2: 44704402 to 44704420

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 44704420 CTTGTTCTTTCCTTTCTTT 44704402

>Solanum tuberosum cultivar MSH/14-112 chromosome 12 Sequence ID: CP046697.1 Length: 61134531 Range 1: 17959654 to 17959671

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 17959654 TTGTTCTTACCTTTCTTT 17959671

>Solanum tuberosum cultivar MSH/14-112 chromosome 2 Sequence ID: CP046695.1 Length: 48610271 Range 1: 14071325 to 14071342

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 14071342 TTGTTCTTACCTTTCTTT 14071325

Range 2: 44702757 to 44702775

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 44702775 CTTGTTCTTTCCTTTCTTT 44702757

>Vibrio sp. THAF191c plasmid pTHAF191c_b, complete sequence Sequence ID: CP046163.1 Length: 1848698 Range 1: 808203 to 808220

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 808220 ACTTGTTCTTACCTTTCT 808203

>Sciurus carolinensis genome assembly, chromosome: 18 Sequence ID: LR738608.1 Length: 41557064 Range 1: 7971639 to 7971656

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 7971639 TTGTTCTTACCTTTCTTT 7971656

Range 2: 689107 to 689121

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 689107 CTTGTTCTTACCTTT 689121

Range 3: 25970442 to 25970456

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 25970442 TGTTCTTACCTTTCT 25970456

>Vibrio sp. THAF191d plasmid pTHAF191d_b, complete sequence Sequence ID: CP046066.1 Length: 1847800 Range 1: 991589 to 991606

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 991606 ACTTGTTCTTACCTTTCT 991589

>Vibrio sp. THAF64 plasmid pTHAF64_a, complete sequence Sequence ID: CP045356.1 Length: 1848699 Range 1: 768328 to 768345

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 768328 ACTTGTTCTTACCTTTCT 768345

>Parastagonospora nodorum strain Sn79 chromosome 20 Sequence ID: CP039689.1 Length: 1046119 Range 1: 317715 to 317732

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 317715 CTTGTTCTTACCTTTCTT 317732

>Rattus norvegicus autism susceptibility candidate 2-like 1 (Auts2l1), mRNA Sequence ID: NM_001107136.2 Length: 6392 Range 1: 4234 to 4251

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 4234 TTGTTCTTACCTTTCTTT 4251

>Gossypium turneri isolate D10-2 chromosome D10_03 Sequence ID: CP032573.1 Length: 64909839 Range 1: 21443606 to 21443623

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 21443606 TTGTTCTTACCTTTCTTT 21443623

Range 2: 14449196 to 14449212

Score:34.2 bits(17), Expect:28, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTTT 20 ||||||||||||||||| Sbjct 14449212 TGTTCTTACCTTTCTTT 14449196

Range 3: 47309983 to 47309998

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 GTTCTTACCTTTCTTT 20 |||||||||||||||| Sbjct 47309983 GTTCTTACCTTTCTTT 47309998

Range 4: 57893369 to 57893384

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 57893369 TGTTCTTACCTTTCTT 57893384

Range 5: 9729881 to 9729895

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 9729895 TGTTCTTACCTTTCT 9729881

Range 6: 34519627 to 34519641

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34519641 TGTTCTTACCTTTCT 34519627

Range 7: 34674448 to 34674462

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34674462 TGTTCTTACCTTTCT 34674448

Range 8: 34755637 to 34755651

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34755637 TGTTCTTACCTTTCT 34755651

Range 9: 34852619 to 34852633

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34852633 TGTTCTTACCTTTCT 34852619

Range 10: 34933122 to 34933136

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34933136 TGTTCTTACCTTTCT 34933122

Range 11: 34964191 to 34964205

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34964205 TGTTCTTACCTTTCT 34964191

Range 12: 34996962 to 34996976

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34996976 TGTTCTTACCTTTCT 34996962

Range 13: 35287531 to 35287545

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 35287531 TGTTCTTACCTTTCT 35287545

Range 14: 39345061 to 39345075

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 39345075 CTTGTTCTTACCTTT 39345061

Range 15: 57584258 to 57584272

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 57584272 TTCTTACCTTTCTTT 57584258

>Chanos chanos genome assembly, chromosome: 4 Sequence ID: LR697109.1 Length: 53909382 Range 1: 18477041 to 18477058

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 18477041 TTGTTCTTACCTTTCTTT 18477058

Range 2: 6223334 to 6223348

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 6223334 TGTTCTTACCTTTCT 6223348

Range 3: 25692107 to 25692121

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTT 15 ||||||||||||||| Sbjct 25692107 ACTTGTTCTTACCTT 25692121

Range 4: 35639311 to 35639325

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 35639311 TTCTTACCTTTCTTT 35639325

>Sparus aurata genome assembly, chromosome: 13 Sequence ID: LR537133.1 Length: 35791275 Range 1: 27437526 to 27437543

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 27437526 TTGTTCTTACCTTTCTTT 27437543

Range 2: 1070934 to 1070948

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 1070948 CTTGTTCTTACCTTT 1070934

>Haemonchus contortus strain NZ_Hco_NP chromosome 3 Sequence ID: CP035802.1 Length: 83970805 Range 1: 56074697 to 56074714

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 56074697 CTTGTTCTTACCTTTCTT 56074714

Range 2: 17235784 to 17235798

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 17235798 CTTGTTCTTACCTTT 17235784

>Aquila chrysaetos chrysaetos genome assembly, chromosome: 6 Sequence ID: LR606186.1 Length: 54402963 Range 1: 31990359 to 31990376

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 31990359 TTGTTCTTACCTTTCTTT 31990376

Range 2: 2435802 to 2435816

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 2435816 TTCTTACCTTTCTTT 2435802

Range 3: 7523051 to 7523065

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 7523065 TGTTCTTACCTTTCT 7523051

Range 4: 33077817 to 33077835

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 33077835 CTTGTTCTTTCCTTTCTTT 33077817

Range 5: 41983999 to 41984013

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTC 17 ||||||||||||||| Sbjct 41984013 TTGTTCTTACCTTTC 41983999

>Myripristis murdjan genome assembly, chromosome: 22 Sequence ID: LR597571.1 Length: 31899175 Range 1: 11947947 to 11947964

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 11947947 TTGTTCTTACCTTTCTTT 11947964

Range 2: 26632064 to 26632079

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTT 16 |||||||||||||||| Sbjct 26632064 ACTTGTTCTTACCTTT 26632079

Range 3: 8224944 to 8224958

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 8224958 TGTTCTTACCTTTCT 8224944

>Sphaeramia orbicularis genome assembly, chromosome: 7 Sequence ID: LR597464.1 Length: 57165184 Range 1: 16133592 to 16133609

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 16133609 CTTGTTCTTACCTTTCTT 16133592

>Shewanella marisflavi strain ECSMB14101 chromosome, complete genome Sequence ID: CP041153.1 Length: 4343492 Range 1: 575882 to 575899

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 575882 TTGTTCTTACCTTTCTTT 575899

>Gossypium raimondii isolate D5-4 chromosome D5_03 Sequence ID: CP032555.1 Length: 63031283 Range 1: 21539863 to 21539880

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 21539863 TTGTTCTTACCTTTCTTT 21539880

Range 2: 14521698 to 14521714

Score:34.2 bits(17), Expect:28, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTTT 20 ||||||||||||||||| Sbjct 14521714 TGTTCTTACCTTTCTTT 14521698

Range 3: 32954384 to 32954398

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 32954384 TGTTCTTACCTTTCT 32954398

Range 4: 34118876 to 34118890

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 34118890 TGTTCTTACCTTTCT 34118876

Range 5: 37661302 to 37661316

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 37661316 CTTGTTCTTACCTTT 37661302

>Streptopelia turtur genome assembly, chromosome: 7 Sequence ID: LR594557.1 Length: 42930475 Range 1: 15433621 to 15433638

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 15433621 ACTTGTTCTTACCTTTCT 15433638

Range 2: 20295417 to 20295432

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 20295432 TGTTCTTACCTTTCTT 20295417

Range 3: 28381539 to 28381554

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 GTTCTTACCTTTCTTT 20 |||||||||||||||| Sbjct 28381539 GTTCTTACCTTTCTTT 28381554

Range 4: 5655099 to 5655117

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTTT 20 |||||||||||||| |||| Sbjct 5655099 CTTGTTCTTACCTTCCTTT 5655117

Range 5: 33671815 to 33671829

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTC 17 ||||||||||||||| Sbjct 33671815 TTGTTCTTACCTTTC 33671829

>Streptopelia turtur genome assembly, chromosome: Z Sequence ID: LR594555.1 Length: 73908008 Range 1: 12632059 to 12632076

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 12632076 TTGTTCTTACCTTTCTTT 12632059

Range 2: 4565056 to 4565074

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCTT 19 ||||||| ||||||||||| Sbjct 4565056 ACTTGTTTTTACCTTTCTT 4565074

Range 3: 16836719 to 16836737

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTT 19 |||| |||||||||||||| Sbjct 16836737 ACTTTTTCTTACCTTTCTT 16836719

Range 4: 16836761 to 16836779

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTT 19 |||| |||||||||||||| Sbjct 16836779 ACTTTTTCTTACCTTTCTT 16836761

Range 5: 25557806 to 25557820

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 25557820 TTCTTACCTTTCTTT 25557806

Range 6: 57283740 to 57283754

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 57283754 TTCTTACCTTTCTTT 57283740

Range 7: 61765068 to 61765082

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 61765068 TTCTTACCTTTCTTT 61765082

Range 8: 69615238 to 69615252

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 69615238 TGTTCTTACCTTTCT 69615252

Range 9: 73290643 to 73290657

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 73290643 TTCTTACCTTTCTTT 73290657

>Syngnathus acus genome assembly, chromosome: 9 Sequence ID: LR594594.1 Length: 20014430 Range 1: 9342108 to 9342125

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 9342125 CTTGTTCTTACCTTTCTT 9342108

Range 2: 8525231 to 8525245

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 8525245 TTCTTACCTTTCTTT 8525231

Range 3: 9029531 to 9029545

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 9029531 TTCTTACCTTTCTTT 9029545

>PREDICTED: Elaeis guineensis protein SMAX1-like (LOC105039233), mRNA Sequence ID: XM_010915312.3 Length: 3827 Range 1: 3655 to 3672

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 3655 TTGTTCTTACCTTTCTTT 3672

>Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Cambria0299, complete genome Sequence ID: MK764040.1 Length: 7529 Range 1: 2633 to 2650

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2650 CTTGTTCTTACCTTTCTT 2633

>Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Cambria0298 nonstructural polyprotein (ORF1), VP1 (ORF2), and VP2 (ORF3) genes, complete cds Sequence ID: MK764039.1 Length: 7512 Range 1: 2632 to 2649

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2649 CTTGTTCTTACCTTTCTT 2632

>Salmo trutta genome assembly, chromosome: 12 Sequence ID: LR584441.1 Length: 97529106 Range 1: 77138227 to 77138244

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 77138227 TTGTTCTTACCTTTCTTT 77138244

Range 2: 676407 to 676422

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 676422 TGTTCTTACCTTTCTT 676407

Range 3: 2971079 to 2971094

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 2971094 TGTTCTTACCTTTCTT 2971079

Range 4: 3513809 to 3513824

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 3513824 TGTTCTTACCTTTCTT 3513809

Range 5: 4267172 to 4267187

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 4267187 TGTTCTTACCTTTCTT 4267172

Range 6: 11819548 to 11819563

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 11819563 TGTTCTTACCTTTCTT 11819548

Range 7: 52104224 to 52104239

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 52104239 TGTTCTTACCTTTCTT 52104224

Range 8: 52398708 to 52398723

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 52398723 TGTTCTTACCTTTCTT 52398708

Range 9: 60276545 to 60276560

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 60276545 TGTTCTTACCTTTCTT 60276560

Range 10: 68895724 to 68895739

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 4 TGTTCTTACCTTTCTT 19 |||||||||||||||| Sbjct 68895724 TGTTCTTACCTTTCTT 68895739

Range 11: 4430460 to 4430474

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 4430474 TTCTTACCTTTCTTT 4430460

Range 12: 4432672 to 4432686

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 4432686 TTCTTACCTTTCTTT 4432672

Range 13: 4434884 to 4434898

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 4434898 TTCTTACCTTTCTTT 4434884

Range 14: 4437096 to 4437110

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 4437110 TTCTTACCTTTCTTT 4437096

Range 15: 4439306 to 4439320

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 4439320 TTCTTACCTTTCTTT 4439306

Range 16: 4441516 to 4441530

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 4441530 TTCTTACCTTTCTTT 4441516

Range 17: 5730085 to 5730099

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 5730099 CTTGTTCTTACCTTT 5730085

Range 18: 67221797 to 67221811

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 4 TGTTCTTACCTTTCT 18 ||||||||||||||| Sbjct 67221811 TGTTCTTACCTTTCT 67221797

Range 19: 78157710 to 78157724

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 78157710 CTTGTTCTTACCTTT 78157724

>Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Douglas0940 nonstructural polyprotein (ORF1), VP1 (ORF2), and VP2 (ORF3) genes, complete cds Sequence ID: MK753012.1 Length: 7505 Range 1: 2632 to 2649

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2649 CTTGTTCTTACCTTTCTT 2632

>Norovirus GII isolate Hu/US/2016/GII.P2-GII.2/Washington0526 nonstructural polyprotein (ORF1), VP1 (ORF2), and VP2 (ORF3) genes, complete cds Sequence ID: MK753007.1 Length: 7533 Range 1: 2630 to 2647

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2647 CTTGTTCTTACCTTTCTT 2630

>Takifugu rubripes genome assembly, chromosome: 7 Sequence ID: LR584238.1 Length: 17515293 Range 1: 7696759 to 7696776

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 7696776 TTGTTCTTACCTTTCTTT 7696759

>Scleropages formosus genome assembly, chromosome: 5 Sequence ID: LR584070.1 Length: 38535925 Range 1: 14020005 to 14020022

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 14020005 TTGTTCTTACCTTTCTTT 14020022

>Homo sapiens chromosome 15 clone VMRC59-280I06, complete sequence Sequence ID: AC279072.1 Length: 86744 Range 1: 677 to 694

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 694 CTTGTTCTTACCTTTCTT 677

>Homo sapiens chromosome 10 clone VMRC53-75M10, complete sequence Sequence ID: AC278846.1 Length: 173136 Range 1: 102948 to 102965

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 102965 CTTGTTCTTACCTTTCTT 102948

>Homo sapiens chromosome 10 clone VMRC62-410O10, complete sequence Sequence ID: AC278634.1 Length: 157622 Range 1: 61389 to 61406

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 61389 CTTGTTCTTACCTTTCTT 61406

>Homo sapiens chromosome 10 clone VMRC62-122A13, complete sequence Sequence ID: AC278587.1 Length: 175758 Range 1: 70222 to 70239

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 70222 CTTGTTCTTACCTTTCTT 70239

>Homo sapiens chromosome 10 clone VMRC62-224B15, complete sequence Sequence ID: AC278459.1 Length: 161945 Range 1: 71985 to 72002

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 71985 CTTGTTCTTACCTTTCTT 72002

>Homo sapiens chromosome 10 clone VMRC64-249A18, complete sequence Sequence ID: AC278253.1 Length: 131022 Range 1: 61344 to 61361

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 61344 CTTGTTCTTACCTTTCTT 61361

>Betta splendens genome assembly, chromosome: 16 Sequence ID: LR132009.2 Length: 21788636 Range 1: 16435557 to 16435574

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 16435574 TTGTTCTTACCTTTCTTT 16435557

>Gouania willdenowi genome assembly, chromosome: 21 Sequence ID: LR132001.1 Length: 38978045 Range 1: 29381451 to 29381468

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 29381468 TTGTTCTTACCTTTCTTT 29381451

Range 2: 33218941 to 33218956

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTT 16 |||||||||||||||| Sbjct 33218956 ACTTGTTCTTACCTTT 33218941

Range 3: 12501782 to 12501796

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 12501782 TTCTTACCTTTCTTT 12501796

Range 4: 22805587 to 22805601

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 22805587 TTCTTACCTTTCTTT 22805601

>Brassica oleracea HDEM genome, scaffold: C1 Sequence ID: LR031878.1 Length: 52030199 Range 1: 7174753 to 7174770

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 7174753 TTGTTCTTACCTTTCTTT 7174770

Range 2: 2870387 to 2870402

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCT 18 |||||||||||||||| Sbjct 2870387 TTGTTCTTACCTTTCT 2870402

Range 3: 22951949 to 22951967

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 |||||||||| |||||||| Sbjct 22951967 CTTGTTCTTATCTTTCTTT 22951949

Range 4: 42654558 to 42654576

Score:30.2 bits(15), Expect:444, Identities:18/19(95%), Gaps:0/19(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTTT 20 ||||||||| ||||||||| Sbjct 42654576 CTTGTTCTTCCCTTTCTTT 42654558

>Haemonchus contortus, ISE/inbred ISE, WGS project CAVP01000000 data, chromosome: 3 Sequence ID: LS997564.1 Length: 43560352 Range 1: 28197511 to 28197528

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 28197511 CTTGTTCTTACCTTTCTT 28197528

Range 2: 8970345 to 8970359

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTT 16 ||||||||||||||| Sbjct 8970359 CTTGTTCTTACCTTT 8970345

Range 3: 21358310 to 21358324

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 21358310 TTCTTACCTTTCTTT 21358324

>Eukaryotic synthetic construct chromosome 19 Sequence ID: CP034522.1 Length: 64242768 Range 1: 52225605 to 52225622

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 52225605 TTGTTCTTACCTTTCTTT 52225622

>Eukaryotic synthetic construct chromosome 19 Sequence ID: CP034497.1 Length: 64242768 Range 1: 52225605 to 52225622

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 52225605 TTGTTCTTACCTTTCTTT 52225622

>Eukaryotic synthetic construct chromosome 15 Sequence ID: CP034493.1 Length: 82521392 >Eukaryotic synthetic construct chromosome 15 Sequence ID: CP034518.1 Length: 82521392 Range 1: 79764140 to 79764157

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 79764157 CTTGTTCTTACCTTTCTT 79764140

Range 2: 6733774 to 6733793

Score:32.2 bits(16), Expect:112, Identities:19/20(95%), Gaps:0/20(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTTTCTTT 20 |||| ||||||||||||||| Sbjct 6733793 ACTTCTTCTTACCTTTCTTT 6733774

Range 3: 19223498 to 19223512

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 19223498 TTCTTACCTTTCTTT 19223512

>Vibrio coralliilyticus strain RE22 chromosome 2, complete sequence Sequence ID: CP031473.1 Length: 1915494 Range 1: 825299 to 825316

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 825299 ACTTGTTCTTACCTTTCT 825316

>homo sapiens BAC clone CH17-284L16 from chromosome 10, complete sequence Sequence ID: AC278009.1 Length: 214093 Range 1: 7551 to 7568

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 7551 CTTGTTCTTACCTTTCTT 7568

>Norovirus GII isolate NORO_170_23_09_2014, complete genome Sequence ID: MH218639.1 Length: 7550 Range 1: 2627 to 2644

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2644 CTTGTTCTTACCTTTCTT 2627

>PREDICTED: Gallus gallus FRA10A associated CGG repeat 1 (FRA10AC1), transcript variant X2, misc_RNA Sequence ID: XR_001467220.2 Length: 2915 Range 1: 2863 to 2880

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2880 CTTGTTCTTACCTTTCTT 2863

>Strongyloides ratti Epidermal growth factor-like domain-containing protein (SRAE_1000107000), partial mRNA Sequence ID: XM_024647979.1 Length: 5655 Range 1: 33 to 50

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 33 TTGTTCTTACCTTTCTTT 50

>Fusarium venenatum strain A3/5 genome assembly, chromosome: I Sequence ID: LN649229.1 Length: 11988928 Range 1: 1338623 to 1338640

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 1338640 TTGTTCTTACCTTTCTTT 1338623

>PREDICTED: Lactuca sativa uncharacterized LOC111918660 (LOC111918660), mRNA Sequence ID: XM_023914325.1 Length: 705 Range 1: 405 to 422

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 422 TTGTTCTTACCTTTCTTT 405

>PREDICTED: Spodoptera litura calponin homology domain-containing protein DDB_G0272472 (LOC111364788), transcript variant X4, mRNA Sequence ID: XM_022981828.1 Length: 8983 Range 1: 6138 to 6155

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 6155 TTGTTCTTACCTTTCTTT 6138

>PREDICTED: Spodoptera litura calponin homology domain-containing protein DDB_G0272472 (LOC111364788), transcript variant X3, mRNA Sequence ID: XM_022981827.1 Length: 9005 Range 1: 6160 to 6177

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 6177 TTGTTCTTACCTTTCTTT 6160

>PREDICTED: Spodoptera litura calponin homology domain-containing protein DDB_G0272472 (LOC111364788), transcript variant X2, mRNA Sequence ID: XM_022981826.1 Length: 9014 Range 1: 6169 to 6186

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 6186 TTGTTCTTACCTTTCTTT 6169

>PREDICTED: Spodoptera litura calponin homology domain-containing protein DDB_G0272472 (LOC111364788), transcript variant X1, mRNA Sequence ID: XM_022981825.1 Length: 9035 Range 1: 6190 to 6207

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 6207 TTGTTCTTACCTTTCTTT 6190

>Solanum lycopersicum cultivar I-3 chromosome 3 Sequence ID: CP023759.1 Length: 70793824 Range 1: 68904590 to 68904607

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 68904607 TTGTTCTTACCTTTCTTT 68904590

Range 2: 66219525 to 66219539

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 66219539 TTCTTACCTTTCTTT 66219525

Range 3: 66220266 to 66220280

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 66220280 TTCTTACCTTTCTTT 66220266

Range 4: 66222764 to 66222778

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 66222778 TTCTTACCTTTCTTT 66222764

>Norovirus GII strain Norovirus/GII/Hu/NL/2013/GII.P7-GII.7/Rotterdam/E1300276_p12_d76 ORF1 gene, partial cds; and ORF2 and ORF3 genes, complete cds Sequence ID: MF140648.1 Length: 7525 Range 1: 2613 to 2630

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2630 CTTGTTCTTACCTTTCTT 2613

>Norovirus GII strain Norovirus/GII/Hu/NL/2013/GII.P7-GII.7/Rotterdam/E1300275_p12_d54 ORF1 gene, partial cds; and ORF2 and ORF3 genes, complete cds Sequence ID: MF140647.1 Length: 7525 Range 1: 2609 to 2626

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2626 CTTGTTCTTACCTTTCTT 2609

>Norovirus GII strain Norovirus/GII/Hu/NL/2013/GII.P7-GII.7/Rotterdam/E1300274_p12_d26 ORF1 gene, partial cds; ORF2 gene, complete cds; and ORF3 gene, partial cds Sequence ID: MF140646.1 Length: 7439 Range 1: 2606 to 2623

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2623 CTTGTTCTTACCTTTCTT 2606

>Norovirus GII strain Norovirus/GII/Hu/NL/2013/GII.P7-GII.7/Rotterdam/E1300273_p12_d0 ORF1 gene, partial cds; and ORF2 and ORF3 genes, complete cds Sequence ID: MF140645.1 Length: 7515 Range 1: 2609 to 2626

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2626 CTTGTTCTTACCTTTCTT 2609

>Gossypium hirsutum cultivar TM1 chromosome A11 Sequence ID: CP023743.1 Length: 62133650 Range 1: 43712895 to 43712912

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 43712895 ACTTGTTCTTACCTTTCT 43712912

Range 2: 13683445 to 13683459

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTT 15 ||||||||||||||| Sbjct 13683445 ACTTGTTCTTACCTT 13683459

>Sapovirus GXI/HgTa2-2-2 genomic RNA, nearly complete genome Sequence ID: LC215898.1 Length: 7162 Range 1: 2739 to 2756

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2756 CTTGTTCTTACCTTTCTT 2739

>Sapovirus GVII/Ishi-Im3-1 genomic RNA, nearly complete genome Sequence ID: LC215894.1 Length: 7139 Range 1: 2749 to 2766

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2766 CTTGTTCTTACCTTTCTT 2749

>Sapovirus GVII/Ishi-Im1-2 genomic RNA, nearly complete genome Sequence ID: LC215892.1 Length: 7133 Range 1: 2748 to 2765

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2765 CTTGTTCTTACCTTTCTT 2748

>Sapovirus GVII/MoI2-1-2 genomic RNA, nearly complete genome Sequence ID: LC215891.1 Length: 6786 Range 1: 2386 to 2403

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 2403 CTTGTTCTTACCTTTCTT 2386

>Sapovirus GVI/Ishi-Im7-2 genomic RNA, nearly complete genome Sequence ID: LC215887.1 Length: 6344 Range 1: 1949 to 1966

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 1966 CTTGTTCTTACCTTTCTT 1949

>Lupinus angustifolius cultivar Tanjil chromosome LG-14 Sequence ID: CP023126.1 Length: 21959816 Range 1: 14667385 to 14667402

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 14667385 CTTGTTCTTACCTTTCTT 14667402

Range 2: 11963194 to 11963208

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 1 ACTTGTTCTTACCTT 15 ||||||||||||||| Sbjct 11963208 ACTTGTTCTTACCTT 11963194

>Lupinus angustifolius cultivar Tanjil chromosome LG-09 Sequence ID: CP023121.1 Length: 26161844 Range 1: 14308951 to 14308968

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 14308968 CTTGTTCTTACCTTTCTT 14308951

Range 2: 11317054 to 11317069

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTC 17 |||||||||||||||| Sbjct 11317069 CTTGTTCTTACCTTTC 11317054

Range 3: 6525583 to 6525597

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 6525597 TTCTTACCTTTCTTT 6525583

>Parastagonospora nodorum isolate Sn79-1087 chromosome 20, complete sequence Sequence ID: CP022872.1 Length: 1048157 Range 1: 729106 to 729123

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 729123 CTTGTTCTTACCTTTCTT 729106

>Parastagonospora nodorum isolate Sn2000 chromosome 20 sequence Sequence ID: CP022847.1 Length: 1144392 Range 1: 325041 to 325058

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 325041 CTTGTTCTTACCTTTCTT 325058

>Parastagonospora nodorum isolate LDN03-Sn4 chromosome 20, complete sequence Sequence ID: CP022820.1 Length: 1090035 Range 1: 775593 to 775610

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 775610 CTTGTTCTTACCTTTCTT 775593

>Oryzias latipes strain HNI chromosome 15 Sequence ID: CP020793.1 Length: 28784337 Range 1: 17508775 to 17508792

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 17508792 TTGTTCTTACCTTTCTTT 17508775

>Oryzias latipes strain Hd-rR chromosome 10 sequence Sequence ID: CP020674.1 Length: 31218526 Range 1: 10284211 to 10284228

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCTTT 20 |||||||||||||||||| Sbjct 10284228 TTGTTCTTACCTTTCTTT 10284211

Range 2: 29032422 to 29032437

Score:32.2 bits(16), Expect:112, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 3 TTGTTCTTACCTTTCT 18 |||||||||||||||| Sbjct 29032437 TTGTTCTTACCTTTCT 29032422

Range 3: 22227286 to 22227300

Score:30.2 bits(15), Expect:444, Identities:15/15(100%), Gaps:0/15(0%), Strand: Plus/Minus

Query 6 TTCTTACCTTTCTTT 20 ||||||||||||||| Sbjct 22227300 TTCTTACCTTTCTTT 22227286

>PREDICTED: Hevea brasiliensis transcriptional regulator ATRX-like (LOC110638657), mRNA Sequence ID: XM_021789274.1 Length: 2490 Range 1: 118 to 135

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 118 CTTGTTCTTACCTTTCTT 135

>PREDICTED: Hevea brasiliensis dentin sialophosphoprotein-like (LOC110638647), mRNA Sequence ID: XM_021789257.1 Length: 3545 Range 1: 151 to 168

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 2 CTTGTTCTTACCTTTCTT 19 |||||||||||||||||| Sbjct 151 CTTGTTCTTACCTTTCTT 168

>Vibrio coralliilyticus strain SNUTY-1 chromosome II, complete sequence Sequence ID: CP020454.1 Length: 1976676 Range 1: 448398 to 448415

Score:36.2 bits(18), Expect:7.2, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 ACTTGTTCTTACCTTTCT 18 |||||||||||||||||| Sbjct 448398 ACTTGTTCTTACCTTTCT 448415