Adue0pd001r alignment txt

créé le: 20200427
mis à jour le: 20200428
généré le:20200525_110103



- résultat de la recherche BLAST de la première séquence HIV

Region HIV1a 86-113: HIV-1 isolate 19663.24H9 from Netherlands envelope glycoprotein (env) gene, complete cds Sequence ID: GU455503.1Length: 2598Number of Matches: 1 AATGGTACTAAGAGGTTTGATAACCCTG

RID: ADUE0PD001R Job Title:Nucleotide Sequence Program: BLASTN Database: nt Nucleotide collection (nt) Query #1: Query ID: lcl|Query_30873 Length: 28

Sequences producing significant alignments:

 Max  TotalQueryE  Per.  
Description  ScoreScorecoverValueIdent Accession  
Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and... 56.0  56.0  100%  3e-05100.00 MT108784.1  
Aquila chrysaetos chrysaetos genome assembly, chromosome: 1  34.2  66.4  100%  99  100.00 LR606181.1  
PREDICTED: Parus major F-box and WD repeat domain containing 2... 34.2  34.2  60%  99  100.00 XM_033518547.1
PREDICTED: Parus major F-box and WD repeat domain containing 2... 34.2  34.2  60%  99  100.00 XM_015644774.2
PREDICTED: Parus major F-box and WD repeat domain containing 2... 34.2  34.2  60%  99  100.00 XM_033518546.1
PREDICTED: Lacerta agilis F-box and WD repeat domain containin... 34.2  34.2  60%  99  100.00 XM_033137465.1
PREDICTED: Lacerta agilis F-box and WD repeat domain containin... 34.2  34.2  60%  99  100.00 XM_033137464.1
PREDICTED: Catharus ustulatus F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_033077426.1
PREDICTED: Catharus ustulatus F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_033077425.1
PREDICTED: Tyto alba alba F-box and WD repeat domain containin... 34.2  34.2  60%  99  100.00 XM_032983104.1
PREDICTED: Tyto alba alba F-box and WD repeat domain containin... 34.2  34.2  60%  99  100.00 XM_009964513.2
PREDICTED: Taeniopygia guttata F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_002194275.5
Coregonus sp. 'balchen' genome assembly, chromosome: 16  34.2  34.2  60%  99  100.00 LR778268.1  
PREDICTED: Chiroxiphia lanceolata F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_032708026.1
PREDICTED: Corvus moneduloides F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_032130923.1
PREDICTED: Corvus moneduloides F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_032130922.1
Weissella koreensis strain CBA3615 chromosome  34.2  34.2  60%  99  100.00 CP046070.1  
PREDICTED: Lonchura striata domestica F-box and WD repeat doma... 34.2  34.2  60%  99  100.00 XM_021543756.2
PREDICTED: Geospiza fortis F-box and WD repeat domain containi... 34.2  34.2  60%  99  100.00 XM_005421223.3
Thalassophryne amazonica genome assembly, chromosome: 20  34.2  34.2  60%  99  100.00 LR722985.1  
PREDICTED: Camarhynchus parvulus F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_030961722.1
PREDICTED: Calypte anna F-box and WD repeat domain containing ... 34.2  34.2  60%  99  100.00 XM_030461351.1
PREDICTED: Serinus canaria F-box and WD repeat domain containi... 34.2  34.2  60%  99  100.00 XM_009093307.3
PREDICTED: Sphaeramia orbicularis fibroblast growth...  34.2  34.2  60%  99  100.00 XM_030146130.1
PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat...  34.2  34.2  60%  99  100.00 XM_029999905.1
PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat...  34.2  34.2  60%  99  100.00 XM_029999904.1
PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat...  34.2  34.2  60%  99  100.00 XM_029999903.1
PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat...  34.2  34.2  60%  99  100.00 XM_029999902.1
PREDICTED: Manacus vitellinus F-box and WD repeat domain...  34.2  34.2  60%  99  100.00 XM_018074221.3
Sphaeramia orbicularis genome assembly, chromosome: 10  34.2  34.2  60%  99  100.00 LR597467.1  
Leishmania braziliensis MHOM/BR/75/M2904 genome assembly,...  34.2  34.2  60%  99  100.00 LS997619.1  
Elizabethkingia sp. JS20170427COW chromosome, complete genome  34.2  34.2  60%  99  100.00 CP040694.1  
Salmo trutta genome assembly, chromosome: 38  34.2  34.2  60%  99  100.00 LR584425.1  
Scleropages formosus genome assembly, chromosome: 25  34.2  34.2  60%  99  100.00 LR584090.1  
Morus alba cultivar Heyebai chromosome 3  34.2  34.2  60%  99  100.00 CP050226.1  
PREDICTED: Brassica rapa cysteine-rich receptor-like protein...  34.2  34.2  60%  99  100.00 XM_018657218.2
Saccharomyces pastorianus strain CBS 1483 chromosome ScV  34.2  34.2  60%  99  100.00 CP048986.1  
Plectropomus leopardus DNA, chromosome 21, nearly complete...  34.2  34.2  60%  99  100.00 AP022720.1  
Nostoc sp. ATCC 53789 chromosome, complete genome  34.2  34.2  60%  99  100.00 CP046703.1  
Saccharomyces cerevisiae strain CEN.PK113-7D chromosome V  34.2  34.2  60%  99  100.00 CP046085.1  
Saccharomyces cerevisiae strain SK23 chromosome V  34.2  34.2  60%  99  100.00 CP046470.1  
Candida auris strain B11220 chromosome 5  34.2  34.2  60%  99  100.00 CP043535.1  
Candida auris strain B11245 chromosome 5  34.2  34.2  60%  99  100.00 CP043446.1  
PREDICTED: Suricata suricatta syntrophin beta 1 (SNTB1), mRNA  34.2  34.2  60%  99  100.00 XM_029923369.1
Streptopelia turtur genome assembly, chromosome: 6  34.2  34.2  60%  99  100.00 LR594558.1  
Plasmodium gallinaceum fam-g protein (PGAL8A_00327000), partia... 34.2  34.2  60%  99  100.00 XM_028672295.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00326600), partia... 34.2  34.2  60%  99  100.00 XM_028672292.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00326400), partia... 34.2  34.2  60%  99  100.00 XM_028672291.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00326000), partia... 34.2  34.2  60%  99  100.00 XM_028672286.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00270700), partia... 34.2  34.2  60%  99  100.00 XM_028671687.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00267500), partia... 34.2  34.2  60%  99  100.00 XM_028671651.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00266900), partia... 34.2  34.2  60%  99  100.00 XM_028671645.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00264800), partia... 34.2  34.2  60%  99  100.00 XM_028671397.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00188600), partia... 34.2  34.2  60%  99  100.00 XM_028670570.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00188400), partia... 34.2  34.2  60%  99  100.00 XM_028670568.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00187900), partia... 34.2  34.2  60%  99  100.00 XM_028670562.1
Plasmodium gallinaceum fam-g protein (PGAL8A_00179200), partia... 34.2  34.2  60%  99  100.00 XM_028670117.1
Salmo trutta genome assembly, chromosome: 19  34.2  34.2  60%  99  100.00 LR584427.1  
Salmo trutta genome assembly, chromosome: 27  34.2  66.4  60%  99  100.00 LR584424.1  
Salmo trutta genome assembly, chromosome: 14  34.2  66.4  60%  99  100.00 LR584411.1  
Scleropages formosus genome assembly, chromosome: 21  34.2  34.2  60%  99  100.00 LR584086.1  
PREDICTED: Mastomys coucha solute carrier family 25 member 53...  36.2  36.2  64%  25  100.00 XM_031376749.1
Gossypium turneri isolate D10-2 chromosome D10_06  36.2  72.4  64%  25  100.00 CP032576.1  
Vigna unguiculata cultivar Xiabao 2 chromosome Vu09  36.2  36.2  64%  25  100.00 CP039355.1  
Lateolabrax maculatus chromosome Lm15  36.2  36.2  64%  25  100.00 CP027276.1  
Torulaspora delbrueckii strain COFT1 chromosome 3, complete...  36.2  36.2  64%  25  100.00 CP027649.1  
Bos mutus isolate yakQH1 chromosome 22  36.2  36.2  64%  25  100.00 CP027090.1  
PREDICTED: Olea europaea var. sylvestris uncharacterized...  36.2  36.2  64%  25  100.00 XM_023035392.1
Agarivorans gilvus strain WH0801, complete genome  36.2  36.2  64%  25  100.00 CP013021.1  
Ovis canadensis canadensis isolate 43U chromosome 19 sequence  36.2  36.2  64%  25  100.00 CP011904.1  
Cucumis melo genomic chromosome, chr_10  36.2  36.2  64%  25  100.00 LN713264.1  
Cucumis melo genomic scaffold, anchoredscaffold00063  36.2  36.2  64%  25  100.00 LN681897.1  
Torulaspora delbrueckii hypothetical protein (TDEL0C02280),...  36.2  36.2  64%  25  100.00 XM_003680280.1
PREDICTED: Etheostoma spectabile septin-2-like (LOC116689752),... 36.2  36.2  64%  25  100.00 XM_032516370.1
Paenibacillus guangzhouensis strain KCTC 33171 chromosome,...  36.2  36.2  64%  25  100.00 CP045293.1  
PREDICTED: Microcaecilia unicolor proteasome 26S subunit, ATPa... 36.2  36.2  64%  25  100.00 XM_030200929.1
PREDICTED: Microcaecilia unicolor proteasome 26S subunit, ATPa... 36.2  36.2  64%  25  100.00 XM_030200928.1
PREDICTED: Microcaecilia unicolor proteasome 26S subunit, ATPa... 36.2  36.2  64%  25  100.00 XM_030200927.1
PREDICTED: Cajanus cajan peroxidase 20 (LOC109801355), mRNA  36.2  36.2  64%  25  100.00 XM_020362406.2
Braconidae sp. BIOUG15341-G01 cytochrome oxidase subunit 1 (CO... 36.2  36.2  64%  25  100.00 KY840335.1  
Torulaspora delbrueckii strain NRRL Y-50541 chromosome 3 sequence36.2  36.2  64%  25  100.00 CP011780.1  
Torulaspora delbrueckii CBS 1146 chromosome 3, complete genome  36.2  36.2  64%  25  100.00 HE616744.1  
Plectropomus leopardus DNA, chromosome 16, nearly complete...  34.2  66.4  64%  99  100.00 AP022715.1  
Anabas testudineus genome assembly, chromosome: 15  40.1  40.1  71%  1.6  100.00 LR132040.1  
Helicobacter cinaedi CCUG 18818 = ATCC BAA-847 DNA, complete...  40.1  40.1  71%  1.6  100.00 AP012492.1  
Gossypioides kirkii chromosome KI_01  36.2  100  71%  25  100.00 CP032244.1  
Gossypium raimondii isolate D5-4 chromosome D5_03  34.2  34.2  75%  99  95.24 CP032555.1  
Raphanus sativus genome assembly, chromosome: 5  34.2  98.6  75%  99  100.00 LR778314.1  
Solanum tuberosum cultivar P8 chromosome 12  34.2  34.2  75%  99  95.24 CP046681.1  
Sparus aurata genome assembly, chromosome: 21  34.2  34.2  75%  99  95.24 LR537141.1  
Fremyella diplosiphon NIES-3275 plasmid plasmid04 DNA, nearly...  36.2  36.2  78%  25  95.45 AP018237.1  
Theobroma cacao genome assembly, chromosome: IV  36.2  36.2  78%  25  95.45 LT594791.1  
Cyprinus carpio clone 632628 microsatellite sequence  36.2  36.2  78%  25  95.45 JN755794.1  
Cyprinus carpio genome assembly common carp genome, scaffold...  36.2  36.2  78%  25  95.45 LN594930.1  
Neostethus bicornis genome assembly, chromosome: 22  34.2  66.4  85%  99  95.24 LR738552.1  
PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane...  36.2  36.2  92%  25  92.31 XM_033114011.1
PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane...  36.2  36.2  92%  25  92.31 XM_033114010.1
PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane...  36.2  36.2  92%  25  92.31 XM_033114009.1
PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane...  36.2  36.2  92%  25  92.31 XM_033114008.1
Bat coronavirus RaTG13, complete genome  36.2  36.2  92%  25  92.31 MN996532.1  
nbr            
           
100.000000          

Alignments: >Synthetic construct ORF1ab, spike, ORF3, E, M, ORF6, ORF8, and N genes, complete cds Sequence ID: MT108784.1 Length: 29891 Range 1: 21782 to 21809

Score:56.0 bits(28), Expect:3e-05, Identities:28/28(100%), Gaps:0/28(0%), Strand: Plus/Plus

Query 1 AATGGTACTAAGAGGTTTGATAACCCTG 28 |||||||||||||||||||||||||||| Sbjct 21782 AATGGTACTAAGAGGTTTGATAACCCTG 21809

>Anabas testudineus genome assembly, chromosome: 15 Sequence ID: LR132040.1 Length: 21921250 Range 1: 1971686 to 1971705

Score:40.1 bits(20), Expect:1.6, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGATA 22 |||||||||||||||||||| Sbjct 1971686 TGGTACTAAGAGGTTTGATA 1971705

>Helicobacter cinaedi CCUG 18818 = ATCC BAA-847 DNA, complete genome Sequence ID: AP012492.1 Length: 2240130 >Helicobacter cinaedi isolate MGYG-HGUT-01432 genome assembly, chromosome: 1 Sequence ID: LR698961.1 Length: 2240130 Range 1: 2013348 to 2013367

Score:40.1 bits(20), Expect:1.6, Identities:20/20(100%), Gaps:0/20(0%), Strand: Plus/Plus

Query 7 ACTAAGAGGTTTGATAACCC 26 |||||||||||||||||||| Sbjct 2013348 ACTAAGAGGTTTGATAACCC 2013367

>PREDICTED: Mastomys coucha solute carrier family 25 member 53 (Slc25a53), mRNA Sequence ID: XM_031376749.1 Length: 5476 Range 1: 888 to 905

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 5 GTACTAAGAGGTTTGATA 22 |||||||||||||||||| Sbjct 905 GTACTAAGAGGTTTGATA 888

>Gossypium turneri isolate D10-2 chromosome D10_06 Sequence ID: CP032576.1 Length: 60007698 Range 1: 55864955 to 55864972

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TGGTACTAAGAGGTTTGA 20 |||||||||||||||||| Sbjct 55864972 TGGTACTAAGAGGTTTGA 55864955

Range 2: 55925296 to 55925313

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 3 TGGTACTAAGAGGTTTGA 20 |||||||||||||||||| Sbjct 55925313 TGGTACTAAGAGGTTTGA 55925296

>Vigna unguiculata cultivar Xiabao 2 chromosome Vu09 Sequence ID: CP039355.1 Length: 53937893 Range 1: 44550370 to 44550387

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 6 TACTAAGAGGTTTGATAA 23 |||||||||||||||||| Sbjct 44550387 TACTAAGAGGTTTGATAA 44550370

>Lateolabrax maculatus chromosome Lm15 Sequence ID: CP027276.1 Length: 23659279 Range 1: 13093604 to 13093621

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 AATGGTACTAAGAGGTTT 18 |||||||||||||||||| Sbjct 13093621 AATGGTACTAAGAGGTTT 13093604

>Torulaspora delbrueckii strain COFT1 chromosome 3, complete sequence Sequence ID: CP027649.1 Length: 1318504 Range 1: 900330 to 900347

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 10 AAGAGGTTTGATAACCCT 27 |||||||||||||||||| Sbjct 900347 AAGAGGTTTGATAACCCT 900330

>Bos mutus isolate yakQH1 chromosome 22 Sequence ID: CP027090.1 Length: 59497618 Range 1: 58024237 to 58024254

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 11 AGAGGTTTGATAACCCTG 28 |||||||||||||||||| Sbjct 58024254 AGAGGTTTGATAACCCTG 58024237

>PREDICTED: Olea europaea var. sylvestris uncharacterized LOC111406154 (LOC111406154), transcript variant X2, mRNA Sequence ID: XM_023035392.1 Length: 3867 Range 1: 257 to 274

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 9 TAAGAGGTTTGATAACCC 26 |||||||||||||||||| Sbjct 274 TAAGAGGTTTGATAACCC 257

>Fremyella diplosiphon NIES-3275 plasmid plasmid04 DNA, nearly complete genome Sequence ID: AP018237.1 Length: 175368 Range 1: 87492 to 87513

Score:36.2 bits(18), Expect:25, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 2 ATGGTACTAAGAGGTTTGATAA 23 |||||||||| ||||||||||| Sbjct 87513 ATGGTACTAAAAGGTTTGATAA 87492

>Theobroma cacao genome assembly, chromosome: IV Sequence ID: LT594791.1 Length: 31929104 Range 1: 21505096 to 21505117

Score:36.2 bits(18), Expect:25, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 4 GGTACTAAGAGGTTTGATAACC 25 ||||||||||||||| |||||| Sbjct 21505117 GGTACTAAGAGGTTTAATAACC 21505096

>Agarivorans gilvus strain WH0801, complete genome Sequence ID: CP013021.1 Length: 4416600 Range 1: 3021747 to 3021764

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 1 AATGGTACTAAGAGGTTT 18 |||||||||||||||||| Sbjct 3021764 AATGGTACTAAGAGGTTT 3021747

>Ovis canadensis canadensis isolate 43U chromosome 19 sequence Sequence ID: CP011904.1 Length: 60532937 Range 1: 57734401 to 57734418

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 11 AGAGGTTTGATAACCCTG 28 |||||||||||||||||| Sbjct 57734418 AGAGGTTTGATAACCCTG 57734401

>Cucumis melo genomic chromosome, chr_10 Sequence ID: LN713264.1 Length: 25362315 Range 1: 6372589 to 6372606

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 9 TAAGAGGTTTGATAACCC 26 |||||||||||||||||| Sbjct 6372606 TAAGAGGTTTGATAACCC 6372589

>Cucumis melo genomic scaffold, anchoredscaffold00063 Sequence ID: LN681897.1 Length: 2024649 Range 1: 705580 to 705597

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 9 TAAGAGGTTTGATAACCC 26 |||||||||||||||||| Sbjct 705597 TAAGAGGTTTGATAACCC 705580

>Cyprinus carpio clone 632628 microsatellite sequence Sequence ID: JN755794.1 Length: 1404 Range 1: 317 to 338

Score:36.2 bits(18), Expect:25, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Minus

Query 2 ATGGTACTAAGAGGTTTGATAA 23 |||||||||| ||||||||||| Sbjct 338 ATGGTACTAAAAGGTTTGATAA 317

>Torulaspora delbrueckii hypothetical protein (TDEL0C02280), partial mRNA Sequence ID: XM_003680280.1 Length: 1068 Range 1: 112 to 129

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Minus

Query 10 AAGAGGTTTGATAACCCT 27 |||||||||||||||||| Sbjct 129 AAGAGGTTTGATAACCCT 112

>PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane nucleoporin (NDC1), transcript variant X4, mRNA Sequence ID: XM_033114011.1 Length: 2393 Range 1: 567 to 592

Score:36.2 bits(18), Expect:25, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGATAACCCTG 28 |||||||||||| || |||||||||| Sbjct 567 TGGTACTAAGAGCTTAGATAACCCTG 592

>PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane nucleoporin (NDC1), transcript variant X3, mRNA Sequence ID: XM_033114010.1 Length: 4570 Range 1: 625 to 650

Score:36.2 bits(18), Expect:25, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGATAACCCTG 28 |||||||||||| || |||||||||| Sbjct 625 TGGTACTAAGAGCTTAGATAACCCTG 650

>PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane nucleoporin (NDC1), transcript variant X2, mRNA Sequence ID: XM_033114009.1 Length: 2348 Range 1: 522 to 547

Score:36.2 bits(18), Expect:25, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGATAACCCTG 28 |||||||||||| || |||||||||| Sbjct 522 TGGTACTAAGAGCTTAGATAACCCTG 547

>PREDICTED: Rhinolophus ferrumequinum NDC1 transmembrane nucleoporin (NDC1), transcript variant X1, mRNA Sequence ID: XM_033114008.1 Length: 2515 Range 1: 679 to 704

Score:36.2 bits(18), Expect:25, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGATAACCCTG 28 |||||||||||| || |||||||||| Sbjct 679 TGGTACTAAGAGCTTAGATAACCCTG 704

>PREDICTED: Etheostoma spectabile septin-2-like (LOC116689752), mRNA Sequence ID: XM_032516370.1 Length: 3018 Range 1: 1741 to 1758

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 1 AATGGTACTAAGAGGTTT 18 |||||||||||||||||| Sbjct 1741 AATGGTACTAAGAGGTTT 1758

>Bat coronavirus RaTG13, complete genome Sequence ID: MN996532.1 Length: 29855 Range 1: 21764 to 21789

Score:36.2 bits(18), Expect:25, Identities:24/26(92%), Gaps:0/26(0%), Strand: Plus/Plus

Query 1 AATGGTACTAAGAGGTTTGATAACCC 26 ||||||| ||| |||||||||||||| Sbjct 21764 AATGGTATTAAAAGGTTTGATAACCC 21789

>Paenibacillus guangzhouensis strain KCTC 33171 chromosome, complete genome Sequence ID: CP045293.1 Length: 6903680 Range 1: 2207893 to 2207910

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 11 AGAGGTTTGATAACCCTG 28 |||||||||||||||||| Sbjct 2207893 AGAGGTTTGATAACCCTG 2207910

>PREDICTED: Microcaecilia unicolor proteasome 26S subunit, ATPase 3 (PSMC3), transcript variant X3, mRNA Sequence ID: XM_030200929.1 Length: 1537 Range 1: 940 to 957

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGA 20 |||||||||||||||||| Sbjct 940 TGGTACTAAGAGGTTTGA 957

>PREDICTED: Microcaecilia unicolor proteasome 26S subunit, ATPase 3 (PSMC3), transcript variant X2, mRNA Sequence ID: XM_030200928.1 Length: 1539 Range 1: 942 to 959

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGA 20 |||||||||||||||||| Sbjct 942 TGGTACTAAGAGGTTTGA 959

>PREDICTED: Microcaecilia unicolor proteasome 26S subunit, ATPase 3 (PSMC3), transcript variant X1, mRNA Sequence ID: XM_030200927.1 Length: 1498 Range 1: 901 to 918

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGA 20 |||||||||||||||||| Sbjct 901 TGGTACTAAGAGGTTTGA 918

>PREDICTED: Cajanus cajan peroxidase 20 (LOC109801355), mRNA Sequence ID: XM_020362406.2 Length: 1744 Range 1: 1427 to 1444

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 8 CTAAGAGGTTTGATAACC 25 |||||||||||||||||| Sbjct 1427 CTAAGAGGTTTGATAACC 1444

>Gossypioides kirkii chromosome KI_01 Sequence ID: CP032244.1 Length: 38174113 Range 1: 17718238 to 17718255

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 7 ACTAAGAGGTTTGATAAC 24 |||||||||||||||||| Sbjct 17718238 ACTAAGAGGTTTGATAAC 17718255

Range 2: 11786592 to 11786607

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAAC 24 |||||||||||||||| Sbjct 11786592 TAAGAGGTTTGATAAC 11786607

Range 3: 30599940 to 30599955

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 5 GTACTAAGAGGTTTGA 20 |||||||||||||||| Sbjct 30599940 GTACTAAGAGGTTTGA 30599955

>Braconidae sp. BIOUG15341-G01 cytochrome oxidase subunit 1 (COI) gene, partial cds; mitochondrial Sequence ID: KY840335.1 Length: 579 Range 1: 290 to 307

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 6 TACTAAGAGGTTTGATAA 23 |||||||||||||||||| Sbjct 290 TACTAAGAGGTTTGATAA 307

>Torulaspora delbrueckii strain NRRL Y-50541 chromosome 3 sequence Sequence ID: CP011780.1 Length: 1635806 Range 1: 484710 to 484727

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 10 AAGAGGTTTGATAACCCT 27 |||||||||||||||||| Sbjct 484710 AAGAGGTTTGATAACCCT 484727

>Cyprinus carpio genome assembly common carp genome ,scaffold 000002526 Sequence ID: LN594930.1 Length: 401701 Range 1: 270834 to 270855

Score:36.2 bits(18), Expect:25, Identities:21/22(95%), Gaps:0/22(0%), Strand: Plus/Plus

Query 2 ATGGTACTAAGAGGTTTGATAA 23 |||||||||| ||||||||||| Sbjct 270834 ATGGTACTAAAAGGTTTGATAA 270855

>Torulaspora delbrueckii CBS 1146 chromosome 3, complete genome Sequence ID: HE616744.1 Length: 1292049 Range 1: 398396 to 398413

Score:36.2 bits(18), Expect:25, Identities:18/18(100%), Gaps:0/18(0%), Strand: Plus/Plus

Query 10 AAGAGGTTTGATAACCCT 27 |||||||||||||||||| Sbjct 398396 AAGAGGTTTGATAACCCT 398413

>PREDICTED: Parus major F-box and WD repeat domain containing 2 (FBXW2), transcript variant X3, mRNA Sequence ID: XM_033518547.1 Length: 3687 Range 1: 2579 to 2595

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 2595 GAGGTTTGATAACCCTG 2579

>PREDICTED: Parus major F-box and WD repeat domain containing 2 (FBXW2), transcript variant X2, mRNA Sequence ID: XM_015644774.2 Length: 1878 Range 1: 1274 to 1290

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1290 GAGGTTTGATAACCCTG 1274

>PREDICTED: Parus major F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_033518546.1 Length: 1786 Range 1: 1182 to 1198

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1198 GAGGTTTGATAACCCTG 1182

>PREDICTED: Lacerta agilis F-box and WD repeat domain containing 2 (FBXW2), transcript variant X2, mRNA Sequence ID: XM_033137465.1 Length: 1675 Range 1: 1268 to 1284

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1284 GAGGTTTGATAACCCTG 1268

>PREDICTED: Lacerta agilis F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_033137464.1 Length: 1704 Range 1: 1297 to 1313

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1313 GAGGTTTGATAACCCTG 1297

>PREDICTED: Catharus ustulatus F-box and WD repeat domain containing 2 (FBXW2), transcript variant X2, mRNA Sequence ID: XM_033077426.1 Length: 2105 Range 1: 1202 to 1218

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1218 GAGGTTTGATAACCCTG 1202

>PREDICTED: Catharus ustulatus F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_033077425.1 Length: 3504 Range 1: 2601 to 2617

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 2617 GAGGTTTGATAACCCTG 2601

>PREDICTED: Tyto alba alba F-box and WD repeat domain containing 2 (FBXW2), transcript variant X2, mRNA Sequence ID: XM_032983104.1 Length: 2604 Range 1: 1109 to 1125

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1125 GAGGTTTGATAACCCTG 1109

>PREDICTED: Tyto alba alba F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_009964513.2 Length: 2623 Range 1: 1128 to 1144

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1144 GAGGTTTGATAACCCTG 1128

>PREDICTED: Taeniopygia guttata F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_002194275.5 Length: 4692 Range 1: 1420 to 1436

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1436 GAGGTTTGATAACCCTG 1420

>Coregonus sp. 'balchen' genome assembly, chromosome: 16 Sequence ID: LR778268.1 Length: 54025139 Range 1: 30882307 to 30882323

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 11 AGAGGTTTGATAACCCT 27 ||||||||||||||||| Sbjct 30882323 AGAGGTTTGATAACCCT 30882307

>PREDICTED: Chiroxiphia lanceolata F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_032708026.1 Length: 1988 Range 1: 1384 to 1400

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1400 GAGGTTTGATAACCCTG 1384

>Plectropomus leopardus DNA, chromosome 16, nearly complete sequence Sequence ID: AP022715.1 Length: 32150207 Range 1: 5104243 to 5104259

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 11 AGAGGTTTGATAACCCT 27 ||||||||||||||||| Sbjct 5104259 AGAGGTTTGATAACCCT 5104243

Range 2: 7360788 to 7360803

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 10 AAGAGGTTTGATAACC 25 |||||||||||||||| Sbjct 7360788 AAGAGGTTTGATAACC 7360803

>PREDICTED: Corvus moneduloides F-box and WD repeat domain containing 2 (FBXW2), transcript variant X2, mRNA Sequence ID: XM_032130923.1 Length: 2537 Range 1: 1414 to 1430

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1430 GAGGTTTGATAACCCTG 1414

>PREDICTED: Corvus moneduloides F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_032130922.1 Length: 2455 Range 1: 1332 to 1348

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1348 GAGGTTTGATAACCCTG 1332

>Weissella koreensis strain CBA3615 chromosome Sequence ID: CP046070.1 Length: 1491842 Range 1: 1251670 to 1251686

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 6 TACTAAGAGGTTTGATA 22 ||||||||||||||||| Sbjct 1251686 TACTAAGAGGTTTGATA 1251670

>Neostethus bicornis genome assembly, chromosome: 22 Sequence ID: LR738552.1 Length: 29119677 Range 1: 21997526 to 21997546

Score:34.2 bits(17), Expect:99, Identities:20/21(95%), Gaps:0/21(0%), Strand: Plus/Minus

Query 1 AATGGTACTAAGAGGTTTGAT 21 ||||||||||| ||||||||| Sbjct 21997546 AATGGTACTAAAAGGTTTGAT 21997526

Range 2: 27014870 to 27014885

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 9 TAAGAGGTTTGATAAC 24 |||||||||||||||| Sbjct 27014885 TAAGAGGTTTGATAAC 27014870

>PREDICTED: Lonchura striata domestica F-box and WD repeat domain containing 2 (FBXW2), mRNA Sequence ID: XM_021543756.2 Length: 3022 Range 1: 1412 to 1428

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1428 GAGGTTTGATAACCCTG 1412

>PREDICTED: Geospiza fortis F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_005421223.3 Length: 2402 Range 1: 1867 to 1883

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1883 GAGGTTTGATAACCCTG 1867

>Thalassophryne amazonica genome assembly, chromosome: 20 Sequence ID: LR722985.1 Length: 70111961 Range 1: 29381444 to 29381460

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 29381460 TAAGAGGTTTGATAACC 29381444

>PREDICTED: Camarhynchus parvulus F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_030961722.1 Length: 6277 Range 1: 1231 to 1247

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1247 GAGGTTTGATAACCCTG 1231

>PREDICTED: Calypte anna F-box and WD repeat domain containing 2 (FBXW2), mRNA Sequence ID: XM_030461351.1 Length: 3599 Range 1: 1745 to 1761

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1761 GAGGTTTGATAACCCTG 1745

>PREDICTED: Serinus canaria F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_009093307.3 Length: 1785 Range 1: 1182 to 1198

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1198 GAGGTTTGATAACCCTG 1182

>PREDICTED: Sphaeramia orbicularis fibroblast growth factor-binding protein 2-like (LOC115427547), mRNA Sequence ID: XM_030146130.1 Length: 612 Range 1: 327 to 343

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 343 GAGGTTTGATAACCCTG 327

>PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat domain containing 2 (FBXW2), transcript variant X4, mRNA Sequence ID: XM_029999905.1 Length: 2997 Range 1: 1486 to 1502

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1502 GAGGTTTGATAACCCTG 1486

>PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat domain containing 2 (FBXW2), transcript variant X3, mRNA Sequence ID: XM_029999904.1 Length: 2903 Range 1: 1392 to 1408

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1408 GAGGTTTGATAACCCTG 1392

>PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat domain containing 2 (FBXW2), transcript variant X2, mRNA Sequence ID: XM_029999903.1 Length: 3092 Range 1: 1581 to 1597

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1597 GAGGTTTGATAACCCTG 1581

>PREDICTED: Aquila chrysaetos chrysaetos F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_029999902.1 Length: 2998 Range 1: 1487 to 1503

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1503 GAGGTTTGATAACCCTG 1487

>PREDICTED: Manacus vitellinus F-box and WD repeat domain containing 2 (FBXW2), transcript variant X1, mRNA Sequence ID: XM_018074221.3 Length: 2679 Range 1: 1201 to 1217

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 1217 GAGGTTTGATAACCCTG 1201

>Sphaeramia orbicularis genome assembly, chromosome: 10 Sequence ID: LR597467.1 Length: 55079030 Range 1: 13872130 to 13872146

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 12 GAGGTTTGATAACCCTG 28 ||||||||||||||||| Sbjct 13872146 GAGGTTTGATAACCCTG 13872130

>Leishmania braziliensis MHOM/BR/75/M2904 genome assembly, chromosome: 20 Sequence ID: LS997619.1 Length: 2662849 Range 1: 379107 to 379123

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 3 TGGTACTAAGAGGTTTG 19 ||||||||||||||||| Sbjct 379123 TGGTACTAAGAGGTTTG 379107

>Elizabethkingia sp. JS20170427COW chromosome, complete genome Sequence ID: CP040694.1 Length: 2691279 Range 1: 1156226 to 1156242

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 7 ACTAAGAGGTTTGATAA 23 ||||||||||||||||| Sbjct 1156242 ACTAAGAGGTTTGATAA 1156226

>Gossypium raimondii isolate D5-4 chromosome D5_03 Sequence ID: CP032555.1 Length: 63031283 Range 1: 41482647 to 41482667

Score:34.2 bits(17), Expect:99, Identities:20/21(95%), Gaps:0/21(0%), Strand: Plus/Minus

Query 1 AATGGTACTAAGAGGTTTGAT 21 |||||||| |||||||||||| Sbjct 41482667 AATGGTACAAAGAGGTTTGAT 41482647

>Salmo trutta genome assembly, chromosome: 38 Sequence ID: LR584425.1 Length: 34894132 Range 1: 13813611 to 13813627

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 11 AGAGGTTTGATAACCCT 27 ||||||||||||||||| Sbjct 13813627 AGAGGTTTGATAACCCT 13813611

>Scleropages formosus genome assembly, chromosome: 25 Sequence ID: LR584090.1 Length: 19076140 Range 1: 17059198 to 17059214

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Minus

Query 10 AAGAGGTTTGATAACCC 26 ||||||||||||||||| Sbjct 17059214 AAGAGGTTTGATAACCC 17059198

>Morus alba cultivar Heyebai chromosome 3 Sequence ID: CP050226.1 Length: 25387778 Range 1: 17717545 to 17717561

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 6 TACTAAGAGGTTTGATA 22 ||||||||||||||||| Sbjct 17717545 TACTAAGAGGTTTGATA 17717561

>PREDICTED: Brassica rapa cysteine-rich receptor-like protein kinase 27 (LOC103858893), mRNA Sequence ID: XM_018657218.2 Length: 4022 Range 1: 2220 to 2236

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 2 ATGGTACTAAGAGGTTT 18 ||||||||||||||||| Sbjct 2220 ATGGTACTAAGAGGTTT 2236

>Raphanus sativus genome assembly, chromosome: 5 Sequence ID: LR778314.1 Length: 43617977 Range 1: 7416358 to 7416374

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 2 ATGGTACTAAGAGGTTT 18 ||||||||||||||||| Sbjct 7416358 ATGGTACTAAGAGGTTT 7416374

Range 2: 16794616 to 16794631

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 7 ACTAAGAGGTTTGATA 22 |||||||||||||||| Sbjct 16794631 ACTAAGAGGTTTGATA 16794616

Range 3: 39651838 to 39651853

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 7 ACTAAGAGGTTTGATA 22 |||||||||||||||| Sbjct 39651853 ACTAAGAGGTTTGATA 39651838

>Saccharomyces pastorianus strain CBS 1483 chromosome ScV Sequence ID: CP048986.1 Length: 590107 Range 1: 522419 to 522435

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 5 GTACTAAGAGGTTTGAT 21 ||||||||||||||||| Sbjct 522419 GTACTAAGAGGTTTGAT 522435

>Plectropomus leopardus DNA, chromosome 21, nearly complete sequence Sequence ID: AP022720.1 Length: 25625633 Range 1: 17910599 to 17910615

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 11 AGAGGTTTGATAACCCT 27 ||||||||||||||||| Sbjct 17910599 AGAGGTTTGATAACCCT 17910615

>Nostoc sp. ATCC 53789 chromosome, complete genome Sequence ID: CP046703.1 Length: 7340101 Range 1: 2989543 to 2989559

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 5 GTACTAAGAGGTTTGAT 21 ||||||||||||||||| Sbjct 2989543 GTACTAAGAGGTTTGAT 2989559

>Solanum tuberosum cultivar P8 chromosome 12 Sequence ID: CP046681.1 Length: 61163424 Range 1: 46451284 to 46451304

Score:34.2 bits(17), Expect:99, Identities:20/21(95%), Gaps:0/21(0%), Strand: Plus/Plus

Query 3 TGGTACTAAGAGGTTTGATAA 23 |||||||||||||||| |||| Sbjct 46451284 TGGTACTAAGAGGTTTTATAA 46451304

>Saccharomyces cerevisiae strain CEN.PK113-7D chromosome V Sequence ID: CP046085.1 Length: 577587 Range 1: 501568 to 501584

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 5 GTACTAAGAGGTTTGAT 21 ||||||||||||||||| Sbjct 501568 GTACTAAGAGGTTTGAT 501584

>Saccharomyces cerevisiae strain SK23 chromosome V Sequence ID: CP046470.1 Length: 574155 Range 1: 504923 to 504939

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 5 GTACTAAGAGGTTTGAT 21 ||||||||||||||||| Sbjct 504923 GTACTAAGAGGTTTGAT 504939

>Candida auris strain B11220 chromosome 5 Sequence ID: CP043535.1 Length: 1007026 Range 1: 751634 to 751650

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 10 AAGAGGTTTGATAACCC 26 ||||||||||||||||| Sbjct 751634 AAGAGGTTTGATAACCC 751650

>Candida auris strain B11245 chromosome 5 Sequence ID: CP043446.1 Length: 988297 Range 1: 92501 to 92517

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 10 AAGAGGTTTGATAACCC 26 ||||||||||||||||| Sbjct 92501 AAGAGGTTTGATAACCC 92517

>Sparus aurata genome assembly, chromosome: 21 Sequence ID: LR537141.1 Length: 35160130 Range 1: 8987739 to 8987759

Score:34.2 bits(17), Expect:99, Identities:20/21(95%), Gaps:0/21(0%), Strand: Plus/Plus

Query 1 AATGGTACTAAGAGGTTTGAT 21 ||||||||| ||||||||||| Sbjct 8987739 AATGGTACTCAGAGGTTTGAT 8987759

>PREDICTED: Suricata suricatta syntrophin beta 1 (SNTB1), mRNA Sequence ID: XM_029923369.1 Length: 4744 Range 1: 3242 to 3258

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 3242 TAAGAGGTTTGATAACC 3258

>Aquila chrysaetos chrysaetos genome assembly, chromosome: 1 Sequence ID: LR606181.1 Length: 85456622 Range 1: 53556890 to 53556906

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 1 AATGGTACTAAGAGGTT 17 ||||||||||||||||| Sbjct 53556890 AATGGTACTAAGAGGTT 53556906

Range 2: 48209887 to 48209902

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 13 AGGTTTGATAACCCTG 28 |||||||||||||||| Sbjct 48209902 AGGTTTGATAACCCTG 48209887

>Streptopelia turtur genome assembly, chromosome: 6 Sequence ID: LR594558.1 Length: 40337708 Range 1: 28113781 to 28113797

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 7 ACTAAGAGGTTTGATAA 23 ||||||||||||||||| Sbjct 28113781 ACTAAGAGGTTTGATAA 28113797

>Plasmodium gallinaceum fam-g protein (PGAL8A_00327000), partial mRNA Sequence ID: XM_028672295.1 Length: 1104 Range 1: 1083 to 1099

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 1083 TAAGAGGTTTGATAACC 1099

>Plasmodium gallinaceum fam-g protein (PGAL8A_00326600), partial mRNA Sequence ID: XM_028672292.1 Length: 642 Range 1: 621 to 637

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 621 TAAGAGGTTTGATAACC 637

>Plasmodium gallinaceum fam-g protein (PGAL8A_00326400), partial mRNA Sequence ID: XM_028672291.1 Length: 1377 Range 1: 1356 to 1372

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 1356 TAAGAGGTTTGATAACC 1372

>Plasmodium gallinaceum fam-g protein (PGAL8A_00326000), partial mRNA Sequence ID: XM_028672286.1 Length: 1065 Range 1: 1044 to 1060

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 1044 TAAGAGGTTTGATAACC 1060

>Plasmodium gallinaceum fam-g protein (PGAL8A_00270700), partial mRNA Sequence ID: XM_028671687.1 Length: 1344 Range 1: 1323 to 1339

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 1323 TAAGAGGTTTGATAACC 1339

>Plasmodium gallinaceum fam-g protein (PGAL8A_00267500), partial mRNA Sequence ID: XM_028671651.1 Length: 753 Range 1: 732 to 748

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 732 TAAGAGGTTTGATAACC 748

>Plasmodium gallinaceum fam-g protein (PGAL8A_00266900), partial mRNA Sequence ID: XM_028671645.1 Length: 810 Range 1: 789 to 805

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 789 TAAGAGGTTTGATAACC 805

>Plasmodium gallinaceum fam-g protein (PGAL8A_00264800), partial mRNA Sequence ID: XM_028671397.1 Length: 909 Range 1: 888 to 904

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 888 TAAGAGGTTTGATAACC 904

>Plasmodium gallinaceum fam-g protein (PGAL8A_00188600), partial mRNA Sequence ID: XM_028670570.1 Length: 831 Range 1: 810 to 826

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 810 TAAGAGGTTTGATAACC 826

>Plasmodium gallinaceum fam-g protein (PGAL8A_00188400), partial mRNA Sequence ID: XM_028670568.1 Length: 675 Range 1: 654 to 670

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 654 TAAGAGGTTTGATAACC 670

>Plasmodium gallinaceum fam-g protein (PGAL8A_00187900), partial mRNA Sequence ID: XM_028670562.1 Length: 948 Range 1: 927 to 943

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 927 TAAGAGGTTTGATAACC 943

>Plasmodium gallinaceum fam-g protein (PGAL8A_00179200), partial mRNA Sequence ID: XM_028670117.1 Length: 759 Range 1: 738 to 754

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 738 TAAGAGGTTTGATAACC 754

>Salmo trutta genome assembly, chromosome: 19 Sequence ID: LR584427.1 Length: 56583805 Range 1: 35306968 to 35306984

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 11 AGAGGTTTGATAACCCT 27 ||||||||||||||||| Sbjct 35306968 AGAGGTTTGATAACCCT 35306984

>Salmo trutta genome assembly, chromosome: 27 Sequence ID: LR584424.1 Length: 46405705 Range 1: 16732064 to 16732080

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 11 AGAGGTTTGATAACCCT 27 ||||||||||||||||| Sbjct 16732064 AGAGGTTTGATAACCCT 16732080

Range 2: 17796219 to 17796234

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Plus

Query 11 AGAGGTTTGATAACCC 26 |||||||||||||||| Sbjct 17796219 AGAGGTTTGATAACCC 17796234

>Salmo trutta genome assembly, chromosome: 14 Sequence ID: LR584411.1 Length: 86253525 Range 1: 65747995 to 65748011

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 11 AGAGGTTTGATAACCCT 27 ||||||||||||||||| Sbjct 65747995 AGAGGTTTGATAACCCT 65748011

Range 2: 1749832 to 1749847

Score:32.2 bits(16), Expect:393, Identities:16/16(100%), Gaps:0/16(0%), Strand: Plus/Minus

Query 11 AGAGGTTTGATAACCC 26 |||||||||||||||| Sbjct 1749847 AGAGGTTTGATAACCC 1749832

>Scleropages formosus genome assembly, chromosome: 21 Sequence ID: LR584086.1 Length: 25217654 Range 1: 1078454 to 1078470

Score:34.2 bits(17), Expect:99, Identities:17/17(100%), Gaps:0/17(0%), Strand: Plus/Plus

Query 9 TAAGAGGTTTGATAACC 25 ||||||||||||||||| Sbjct 1078454 TAAGAGGTTTGATAACC 1078470